ID: 1069927526

View in Genome Browser
Species Human (GRCh38)
Location 10:71861207-71861229
Sequence CACCTAAGCCTCCTGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069927526_1069927532 23 Left 1069927526 10:71861207-71861229 CCCAGCTACAGGAGGCTTAGGTG No data
Right 1069927532 10:71861253-71861275 GACCCACTGCACGCCAGCCTGGG No data
1069927526_1069927531 22 Left 1069927526 10:71861207-71861229 CCCAGCTACAGGAGGCTTAGGTG No data
Right 1069927531 10:71861252-71861274 TGACCCACTGCACGCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069927526 Original CRISPR CACCTAAGCCTCCTGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr