ID: 1069930229

View in Genome Browser
Species Human (GRCh38)
Location 10:71876786-71876808
Sequence CTTGCAAATGATGCATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069930229_1069930234 7 Left 1069930229 10:71876786-71876808 CCACCAAATGCATCATTTGCAAG No data
Right 1069930234 10:71876816-71876838 TAATGATAAAAATTTCAAAGGGG No data
1069930229_1069930235 12 Left 1069930229 10:71876786-71876808 CCACCAAATGCATCATTTGCAAG No data
Right 1069930235 10:71876821-71876843 ATAAAAATTTCAAAGGGGCCAGG No data
1069930229_1069930233 6 Left 1069930229 10:71876786-71876808 CCACCAAATGCATCATTTGCAAG No data
Right 1069930233 10:71876815-71876837 CTAATGATAAAAATTTCAAAGGG No data
1069930229_1069930232 5 Left 1069930229 10:71876786-71876808 CCACCAAATGCATCATTTGCAAG No data
Right 1069930232 10:71876814-71876836 GCTAATGATAAAAATTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069930229 Original CRISPR CTTGCAAATGATGCATTTGG TGG (reversed) Intergenic
No off target data available for this crispr