ID: 1069930597

View in Genome Browser
Species Human (GRCh38)
Location 10:71878920-71878942
Sequence CTCATTATCCCTGCTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069930592_1069930597 1 Left 1069930592 10:71878896-71878918 CCCTGCCCTCAGAGTTTTTTCCT 0: 1
1: 0
2: 0
3: 37
4: 416
Right 1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 211
1069930591_1069930597 2 Left 1069930591 10:71878895-71878917 CCCCTGCCCTCAGAGTTTTTTCC 0: 1
1: 0
2: 1
3: 36
4: 336
Right 1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 211
1069930595_1069930597 -5 Left 1069930595 10:71878902-71878924 CCTCAGAGTTTTTTCCTACTCAT 0: 1
1: 0
2: 2
3: 44
4: 241
Right 1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 211
1069930593_1069930597 0 Left 1069930593 10:71878897-71878919 CCTGCCCTCAGAGTTTTTTCCTA 0: 1
1: 0
2: 0
3: 23
4: 251
Right 1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 211
1069930594_1069930597 -4 Left 1069930594 10:71878901-71878923 CCCTCAGAGTTTTTTCCTACTCA 0: 1
1: 0
2: 0
3: 23
4: 399
Right 1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069930597 Original CRISPR CTCATTATCCCTGCTGTCTC TGG Intergenic
901209285 1:7515305-7515327 CTCTTTCTTCCTGATGTCTCAGG - Intronic
901273933 1:7975599-7975621 CTCATAATCACTGCTTTCTGGGG - Intronic
902991643 1:20191656-20191678 GTCATGATCACTGCTGTTTCAGG - Exonic
904874960 1:33647106-33647128 CTCATTTTCCCTTCTGTATAAGG - Intronic
905025316 1:34845663-34845685 CTGATTATCCCTGTGGTCTCTGG - Intronic
905205647 1:36341464-36341486 CTCTTTAACCATGCTGTCTCTGG - Exonic
905353333 1:37362798-37362820 CTCCTTAGTCCCGCTGTCTCTGG - Intergenic
906519898 1:46460816-46460838 CTCATTACCCATGCAGACTCAGG + Intergenic
907402896 1:54235963-54235985 GTCATTATTCCTGCTGTATGAGG + Intronic
908259380 1:62327668-62327690 CACATCATCCCTGCAGACTCAGG - Intergenic
912862440 1:113226015-113226037 CTTGTTATTCCTGCTGTGTCAGG - Intergenic
913326467 1:117632623-117632645 CTCATATCCCCTGCTATCTCAGG + Intergenic
914846387 1:151286034-151286056 CTCTTTTCCCCTGCTTTCTCTGG + Exonic
917381219 1:174410445-174410467 CACATTATCCCTGCTATTACGGG - Intronic
917508104 1:175647451-175647473 CTCATTGTCTCAGGTGTCTCAGG + Intronic
919014409 1:192012759-192012781 CTCATTATCCCAGTTTTCACTGG + Intergenic
919536289 1:198791732-198791754 ATCAGTATCCCTGATGTCTCAGG - Intergenic
919779353 1:201212439-201212461 CCCATTATCCCTGCTTGGTCTGG - Exonic
920674040 1:208026712-208026734 CTCAGCATCTCTGCTTTCTCTGG + Exonic
924510218 1:244723882-244723904 CCCATTCCCCCTGCTGTGTCTGG + Intergenic
1065320787 10:24507354-24507376 TTCATTATCCCTGCCATGTCTGG - Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065901105 10:30208883-30208905 CTCATTAGCCCTCCTTTCTAAGG - Intergenic
1067440604 10:46307323-46307345 CTCATTACCCATGCTGTCCAAGG + Intronic
1067711531 10:48655138-48655160 CTCAATCTCCTTCCTGTCTCAGG + Intronic
1068137620 10:52965855-52965877 CTCAGCATCCCTGTTTTCTCCGG - Intergenic
1068607770 10:59024906-59024928 CTCATTATAATTGCTGTCTGAGG - Intergenic
1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG + Intergenic
1073657566 10:105433936-105433958 CTGATTATCACTGCAGTATCAGG + Intergenic
1074507915 10:114087587-114087609 CTCATGATCCCTTCTGTCTCTGG - Intergenic
1075772134 10:124948098-124948120 GGCATTATTCTTGCTGTCTCAGG - Intronic
1075782041 10:125023409-125023431 CTGATGATCCCTGCTGCATCTGG + Intronic
1076836868 10:133025594-133025616 CACATTATCTCCGCTGTTTCAGG - Intergenic
1078181493 11:9015416-9015438 CTCCTTTTCCCTTCTGACTCAGG + Intergenic
1078522521 11:12074735-12074757 CACATGAGCTCTGCTGTCTCAGG - Intergenic
1078950531 11:16127782-16127804 CTCATTATCCATGCTGTTTGAGG - Intronic
1079209831 11:18450993-18451015 CTCAGTATCCCTTGTGTCTTGGG + Exonic
1083248281 11:61447226-61447248 TTCAGTATCCCTGGTGGCTCAGG + Exonic
1083254316 11:61486882-61486904 CTCTCCATCCCTGCTGCCTCAGG + Intronic
1084307617 11:68297303-68297325 ATCATTATTCCTGCTGGCACAGG + Intergenic
1084771610 11:71346103-71346125 CTCACTGTCCCTGCTGCCTGAGG + Intergenic
1086192018 11:84091291-84091313 CACATTTTCCCTGCAGTTTCTGG + Intronic
1088634079 11:111802512-111802534 CTCATTCCCACTGCCGTCTCCGG - Intronic
1089004501 11:115079644-115079666 CTCATTATTCCTGCTGAAACTGG + Intergenic
1089052364 11:115557036-115557058 CTCACTTTCCCTGCTTCCTCAGG - Intergenic
1089471419 11:118723576-118723598 ATCATTATCCCTTCTTCCTCAGG + Intergenic
1090123753 11:124062937-124062959 CTCATTCTCTCTGCTGCTTCTGG + Intergenic
1091961403 12:4698140-4698162 CGCAGTGTCCATGCTGTCTCTGG + Intronic
1092971105 12:13695961-13695983 CTTATTCTCCCTGCAGTCACAGG - Intronic
1093092378 12:14936417-14936439 ATCATTTTCCCTGCTCTCACGGG + Intronic
1096899097 12:54855926-54855948 CACTCTATCCATGCTGTCTCAGG - Intronic
1097727706 12:63093802-63093824 GTCTTTCTCCCTGCTCTCTCAGG - Intergenic
1099257032 12:80327242-80327264 CTCATGTTCCCTCCTGTCTTTGG + Intronic
1100116992 12:91318603-91318625 CTCTGTATCCCTTCTGTCTATGG + Intergenic
1100339486 12:93664624-93664646 CTCATTATCCATGTAGTCTCAGG - Intergenic
1102591800 12:113961816-113961838 CTCATGGAGCCTGCTGTCTCTGG - Intronic
1103748152 12:123140304-123140326 CCCACTTTCCTTGCTGTCTCTGG - Intronic
1103893448 12:124256868-124256890 CTCATTCTCCCTGCAGGCTCCGG - Intronic
1109771947 13:66986288-66986310 CTCATTATCCCCACTGTCATGGG - Intronic
1109799663 13:67359818-67359840 CTCCTTATCCCTGATATCCCTGG + Intergenic
1110316939 13:74119414-74119436 TTCAGTATCTCTGCTATCTCAGG - Intronic
1110316948 13:74119600-74119622 CTAATTCTTCCTGCTGTGTCAGG - Intronic
1111007770 13:82271811-82271833 TTCATATTCTCTGCTGTCTCTGG + Intergenic
1113034943 13:106038300-106038322 TCCATTGTCCCTGCTGCCTCAGG + Intergenic
1113868719 13:113545496-113545518 CTCATTTTCATTGCTGTTTCTGG + Intronic
1114050050 14:18914763-18914785 CCCAGAGTCCCTGCTGTCTCTGG + Intergenic
1114112508 14:19487168-19487190 CCCAGAGTCCCTGCTGTCTCTGG - Intergenic
1116300367 14:43172856-43172878 CTGTTTATCCCTGCTTTCTAAGG + Intergenic
1117094978 14:52288002-52288024 CTCATTATCTCTGCAATCTGTGG - Intergenic
1117923410 14:60749777-60749799 CTCATTCTATTTGCTGTCTCAGG - Intronic
1118247245 14:64123238-64123260 CTCCTTATCACTGCCGTCACAGG + Intronic
1120380329 14:83769835-83769857 ATCTTTATCCCTTATGTCTCAGG + Intergenic
1121073651 14:91048453-91048475 CTCATTCTCCCTGCAGTCACAGG + Intronic
1122460402 14:101889685-101889707 CGCATCCTCCGTGCTGTCTCAGG - Intronic
1122908583 14:104815311-104815333 CTTATTACCCCTGCTGACTTGGG + Intergenic
1125085895 15:35728808-35728830 CTCTTTTTCTCTGCTATCTCTGG - Intergenic
1125381339 15:39090735-39090757 ATCATTCTCCTAGCTGTCTCAGG + Intergenic
1126703369 15:51386491-51386513 CTCAGTGGCCCTGCTGCCTCTGG - Intronic
1128392909 15:67195192-67195214 CTGATTCTTGCTGCTGTCTCTGG + Exonic
1129121475 15:73399484-73399506 CTCATTTTCCCGGCTAACTCAGG + Intergenic
1129834163 15:78691608-78691630 CTCATTAACCATGTGGTCTCAGG - Intronic
1129951345 15:79594356-79594378 CTCATTCTCCTTTATGTCTCTGG + Intergenic
1130023262 15:80248796-80248818 GTCAGTATGCCTGCTGCCTCTGG + Intergenic
1133026017 16:2989299-2989321 CTCAGTTTCCCTGCTGTCACAGG - Intergenic
1134906701 16:17986066-17986088 CTCATTATACCTGATGGCTTGGG - Intergenic
1135484519 16:22852433-22852455 CGCAATCTCCCTGCTGGCTCTGG + Intronic
1135746996 16:25025870-25025892 CTCATTCTCCCTGCAGTGTCAGG + Intergenic
1138286310 16:55812842-55812864 CCCATCAGCCCTCCTGTCTCTGG - Intronic
1140297988 16:73727267-73727289 CCCAGTATGCCTGCTGTCTCTGG - Intergenic
1140908398 16:79429622-79429644 CTCCTTGTCCCTGGTTTCTCGGG + Intergenic
1141308367 16:82888472-82888494 CTCTCTGTCCCTGCTGCCTCTGG + Intronic
1142882951 17:2895445-2895467 CTCATTTTCCCTGCTGTAAAAGG + Intronic
1142934496 17:3317028-3317050 CTCTTAATCCCTGCAGTCTTTGG - Intergenic
1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG + Intronic
1144217032 17:13065331-13065353 CTCAAGATGCCTCCTGTCTCAGG - Intergenic
1144776947 17:17789610-17789632 CTCATGCTCCCTGCTGTGCCTGG + Intronic
1145991442 17:29081517-29081539 CCCAGTCTACCTGCTGTCTCTGG + Intronic
1146354891 17:32125695-32125717 CTCCTTCTCCCTGCAGTCCCTGG + Intergenic
1147401220 17:40181030-40181052 ATCATTAACCCTTCTGTCTCTGG + Intronic
1147525289 17:41216612-41216634 CTCTATATTCCTCCTGTCTCGGG + Intronic
1148287263 17:46405333-46405355 ATCATTATCCCTGTTGTTTAGGG - Intergenic
1148309433 17:46622913-46622935 ATCATTATCCCTGTTGTTTAGGG - Intronic
1148840782 17:50495480-50495502 CCCATTCTCCCTGCTTTCTCAGG + Intergenic
1149313411 17:55417939-55417961 CTCACTACCCCTCCAGTCTCAGG + Intronic
1150188319 17:63210388-63210410 CTGATTATCCCTCCCTTCTCTGG + Intronic
1150575623 17:66428195-66428217 TTCTTTATCCCTGTTGACTCTGG - Intronic
1152937887 17:83151249-83151271 CTCATAATCCCTGCTTTCTGTGG + Intergenic
1153386195 18:4499511-4499533 CTCAGTATGCCTTCTGTCTTTGG + Intergenic
1155437472 18:25828003-25828025 CTCATCAGCTCTGCTGCCTCTGG - Intergenic
1157401269 18:47390513-47390535 CTCCTTCTCCCTGCTGTGGCTGG - Intergenic
1157526668 18:48388215-48388237 CTAATTATCCCTGCCCTCTCTGG + Intronic
1158052168 18:53235272-53235294 CTCATTATCCCTGCTGGATGTGG + Intronic
1158555392 18:58470848-58470870 TTCTTTCTCCCTTCTGTCTCTGG + Intergenic
1159580996 18:70234689-70234711 CTCATTGTCCATCCTGCCTCTGG + Intergenic
1159957701 18:74531388-74531410 CTCATTATCCCAGCTAGCTGGGG - Intergenic
1159957921 18:74532879-74532901 CTCATTATCCCTGCTAGTTAAGG - Intergenic
1162178147 19:8847084-8847106 CTCCTTAGCCTTGCTGTCTGTGG + Intergenic
1162930019 19:13952927-13952949 CTGATTCTCCCTGCGGCCTCTGG - Intronic
1163299412 19:16434311-16434333 CTCAGTGTCCCTGCTGTGTGTGG - Intronic
1163737404 19:18989996-18990018 CACATTTTCCCTGCAGGCTCCGG + Intergenic
1164783879 19:30914070-30914092 CTCCTAATCCCTGCTGGCACAGG - Intergenic
1166980291 19:46627934-46627956 CTCTTTTTCCCTGCTGCTTCAGG - Intergenic
926694085 2:15758539-15758561 GTTCTCATCCCTGCTGTCTCTGG - Intergenic
927052642 2:19346190-19346212 CTCATCAGCACAGCTGTCTCTGG - Intergenic
927697858 2:25250407-25250429 CTCATTTTCCCAGCTGTTTGGGG - Intronic
928885474 2:36143475-36143497 TTCATTAGCTCTGCTTTCTCCGG + Intergenic
929061657 2:37930764-37930786 CTCACTCTCCCCTCTGTCTCTGG - Intronic
934889978 2:98058927-98058949 CTCATTGTCCCTTCTTTCCCTGG + Intergenic
935107282 2:100056580-100056602 CTCATTATCTCTTCTATCTTGGG + Intronic
935622676 2:105143577-105143599 CTCAGTATCCCTGCGTCCTCGGG + Intergenic
936531902 2:113282385-113282407 GTCATTCTACCTGCTGGCTCAGG + Intergenic
938548935 2:132361650-132361672 CTCTGTGTCCCTGCTGGCTCAGG + Intergenic
939672814 2:145034540-145034562 CTCATTATTTCTGTTATCTCCGG - Intergenic
939708822 2:145489476-145489498 CTGCTTAGCCCTGCTGACTCTGG + Intergenic
943196409 2:184756883-184756905 CTCATTTTCCCAGTTGTCTCTGG - Intronic
944667926 2:201972317-201972339 CTCATTAATCCTCCTGTCCCTGG + Intergenic
945213435 2:207408167-207408189 CTCATCTTCCCTGCTTTCTGTGG - Intergenic
948030911 2:234816676-234816698 TTCTTTTTCCCTGCAGTCTCCGG + Intergenic
948591975 2:239056257-239056279 CTCATCATCCCTCCTGACCCAGG - Intronic
948797817 2:240413605-240413627 GTCATGAGGCCTGCTGTCTCAGG - Intergenic
948917462 2:241042137-241042159 CTCATGCTCCCTCCTGCCTCAGG - Intronic
1171429743 20:25074925-25074947 CTCATTATGGGTGCAGTCTCAGG + Intronic
1172894805 20:38292950-38292972 CTCATTCTCCCTTTTGCCTCAGG + Intronic
1174072713 20:47909960-47909982 CTCCTTAGCTCTGCTGCCTCTGG + Intergenic
1178120183 21:29461702-29461724 CTCATTCTCCCTGCACTCGCTGG + Intronic
1180468530 22:15637138-15637160 CCCAGAGTCCCTGCTGTCTCTGG + Intergenic
1181613251 22:24033697-24033719 CCCTTCATCCCTGCTGTCACGGG + Intronic
1184146991 22:42617598-42617620 CGCATTTTCCATTCTGTCTCTGG - Intergenic
950861188 3:16148988-16149010 CACATCCACCCTGCTGTCTCTGG + Intergenic
950905028 3:16530358-16530380 CTCAGTATCCCTGCTGTGCTGGG + Intergenic
954880182 3:53830286-53830308 TTCATTTTCACTGCTGTCTGGGG - Intronic
955404050 3:58614127-58614149 CCCATTAGCCATGCTGTCCCAGG + Intronic
957302627 3:78412034-78412056 CTCATTATCCCTTCAGCCCCTGG + Intergenic
958823109 3:98998946-98998968 ATCATCATCCCTACTGTGTCAGG - Intergenic
959704303 3:109325476-109325498 CTGATTACACCTGTTGTCTCAGG - Intergenic
960967479 3:123115239-123115261 TTCAGAATCCCTGCTGTCTGAGG + Intronic
961290874 3:125845681-125845703 CTCATTATCTCTGATGCCTTGGG - Intergenic
966127252 3:176593814-176593836 TTCAATATCCCTACTGCCTCAGG - Intergenic
966626899 3:182026716-182026738 CTAATTATTCCTGCTGTGTAGGG + Intergenic
967685904 3:192415822-192415844 CTCATTTTACCTGATGTCTGTGG - Intronic
968073437 3:195802356-195802378 CTCACTGCCCCTGCTGACTCGGG + Intronic
969450775 4:7271817-7271839 CCCACTCTCTCTGCTGTCTCGGG - Intronic
970366135 4:15360018-15360040 GGCATCATCCCTGCTGTCTATGG + Intronic
979088473 4:116446837-116446859 CTCCTCATCCCTTCTGTCTTGGG - Intergenic
981215246 4:142157948-142157970 CACATCCTCCCTGCAGTCTCAGG + Intronic
981228968 4:142330805-142330827 CTCAGTATTCTTGCTGCCTCGGG + Intronic
981578690 4:146230568-146230590 CTCATTATCTCTGCTCTGTCTGG - Intergenic
981855186 4:149280993-149281015 GTCATTATCTTTGTTGTCTCTGG + Intergenic
981934533 4:150224953-150224975 CTCATGCTACCTGCTGTGTCAGG - Intronic
983415683 4:167450425-167450447 CTCATTTTTCCTGCTTACTCAGG - Intergenic
986683001 5:10250563-10250585 CTCCGTCTCCCTGCGGTCTCCGG + Intronic
989197509 5:38730303-38730325 CACATTATCCCTCCAGCCTCTGG + Intergenic
990049601 5:51481245-51481267 CTCATCCTGCCTGCTCTCTCAGG - Intergenic
990306943 5:54503268-54503290 CCCATTATCCCTGCTGGCAAGGG + Intergenic
990492242 5:56313905-56313927 CTCATAATCCCTCCTGCCTCTGG - Intergenic
995356787 5:111246763-111246785 AACCTCATCCCTGCTGTCTCTGG - Intronic
995956569 5:117783806-117783828 TTCATTATCAGTGCTGTCTCAGG - Intergenic
996715805 5:126587152-126587174 CTCATTTTCCCTCCCATCTCTGG - Intronic
999030728 5:148288212-148288234 CTCCTTGCCCCTGCTGACTCGGG + Intergenic
1001412757 5:171522450-171522472 CTCCATTTCCCTGCGGTCTCAGG + Intergenic
1003110560 6:3249170-3249192 GTCATTATACCTGCTGCCTCGGG + Intronic
1006065645 6:31460502-31460524 CTCTTTTTCCCTGCTGGATCAGG + Intergenic
1007296099 6:40821977-40821999 AGCATTATCCTTGGTGTCTCTGG - Intergenic
1007737614 6:43991255-43991277 ATCATTATTCATGCTGTCTCTGG + Intergenic
1008071831 6:47105983-47106005 CTCATTGTTGCTGCTGCCTCTGG - Intergenic
1008265455 6:49419799-49419821 CTAATTTTCCATGCAGTCTCTGG - Intergenic
1008799450 6:55348592-55348614 CACATTTTCCCTGCGTTCTCAGG + Intronic
1012236322 6:96820248-96820270 CTCATCATGCCTGCTGTCCATGG + Intronic
1013874729 6:114811446-114811468 CTCATTCTCCTTAGTGTCTCAGG - Intergenic
1014317692 6:119887892-119887914 CTCATCATACCTCCTCTCTCAGG + Intergenic
1016475306 6:144420892-144420914 CTCGTTATCATTGCTTTCTCAGG + Intronic
1017065823 6:150528263-150528285 CCCATGACCCCTGCTTTCTCAGG + Intergenic
1017511814 6:155121257-155121279 CTCATAATAACTGCTGTTTCAGG - Intronic
1018003349 6:159598708-159598730 GTCACTGTCCCTGCTGCCTCTGG - Intergenic
1018827105 6:167416497-167416519 CTCATTCTCTTTGCTGTCACAGG + Intergenic
1021336870 7:19414085-19414107 TTCATTGTCCCTGGTGGCTCAGG - Intergenic
1021692372 7:23243063-23243085 CTCATTGGCCCCTCTGTCTCTGG - Intronic
1024254731 7:47532074-47532096 CCCACCATCCCTGCTGGCTCAGG + Intronic
1028165914 7:87538433-87538455 CACATTTTACCAGCTGTCTCTGG - Intronic
1030549865 7:110945136-110945158 CACATTCTCCCCACTGTCTCTGG - Intronic
1032436948 7:131908612-131908634 CTCATTTCACCTGGTGTCTCTGG - Intergenic
1033741797 7:144281951-144281973 CCCATCATCACTGCTGTTTCAGG - Intergenic
1033752104 7:144367663-144367685 CCCATCATCACTGCTGTTTCAGG + Intronic
1035218458 7:157389774-157389796 ATCATAAACTCTGCTGTCTCTGG - Intronic
1039882562 8:41634105-41634127 CCGAATATCCCTGCTGGCTCTGG + Intergenic
1042448859 8:68921492-68921514 CTCATTACATCTGCTGTCTCTGG + Intergenic
1042653421 8:71068504-71068526 CTCATGATTCCTGCTGACTTTGG - Intergenic
1043222883 8:77688651-77688673 CTCATTATACCTTCTGTCTTTGG + Intergenic
1043714313 8:83462154-83462176 CTTATTCTCCCTTCTTTCTCTGG + Intergenic
1044566249 8:93663634-93663656 CTCATTATCCCTCCTCCCTTTGG + Intergenic
1046893785 8:119451009-119451031 ATCATTATCCCTCCTTGCTCCGG + Intergenic
1047318453 8:123755466-123755488 CTTGGTATCCCTGCTTTCTCAGG - Intergenic
1048872170 8:138808207-138808229 TTCATTATTCCTCCTGTCTGAGG - Intronic
1049479631 8:142815706-142815728 CCCTTTCTCCCTGCTGCCTCTGG + Intergenic
1050583098 9:7081665-7081687 CCCATTATCCCTGTAGGCTCTGG - Intergenic
1051434648 9:17018164-17018186 CTCACTACCCCTGCAGTCCCTGG - Intergenic
1053751963 9:41266260-41266282 CTCTGTGTCCCTGCTGGCTCAGG - Intergenic
1054257486 9:62830590-62830612 CTCTGTGTCCCTGCTGGCTCAGG - Intergenic
1054333829 9:63785132-63785154 CTCTGTGTCCCTGCTGGCTCAGG + Intergenic
1054806944 9:69404507-69404529 CTCATACTCTCTGCTGTCACTGG - Intergenic
1055013640 9:71593323-71593345 CTCATTTTCCATGCTCTCCCTGG + Intergenic
1056826265 9:89878346-89878368 CTCCTTCTCCCTGCCTTCTCTGG - Intergenic
1060018519 9:120108194-120108216 TTCATTTTGCTTGCTGTCTCTGG - Intergenic
1060215940 9:121738202-121738224 CTCATTAGCCCTGCAGCCTAGGG - Intronic
1061808357 9:133148802-133148824 CTCAGTTTCCCTACTGTCCCGGG + Intronic
1186562820 X:10630893-10630915 TTCATTCTCCCAGCTGTCCCAGG - Intronic
1187476294 X:19614082-19614104 CTCCTAGTCCCTGCTGCCTCAGG + Intronic
1188612937 X:32121478-32121500 CACATTATTCCTGCTGCCTGTGG + Intronic
1189428147 X:40920888-40920910 CTCATTCTCCTTGCTGTATCTGG + Intergenic
1192601355 X:72467778-72467800 CTCCTTATCCTTGCTGTCACTGG - Intronic
1192694155 X:73397161-73397183 CTCATTATCTCATCTCTCTCAGG + Intergenic
1192822075 X:74656465-74656487 CTCTCTAGCCCTGCTGTCACTGG - Intergenic
1195102072 X:101564861-101564883 CTCATAATATCTTCTGTCTCTGG + Intergenic
1195212242 X:102660953-102660975 CTCTCTCTCCCTGCTGTCTTGGG + Intergenic
1195218284 X:102721698-102721720 CTCTCTCTCCCTGCTGTCTTGGG + Intronic
1195614686 X:106903062-106903084 CTCATTTTCCTTCCTCTCTCAGG + Intronic
1198428303 X:136541478-136541500 CTCATAAGCTCTGCTGCCTCAGG + Intronic
1202101846 Y:21317630-21317652 AGCATCATCCCTGGTGTCTCAGG - Intergenic