ID: 1069930605

View in Genome Browser
Species Human (GRCh38)
Location 10:71878994-71879016
Sequence CCAGGTGCAGCCATGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069930605_1069930610 -1 Left 1069930605 10:71878994-71879016 CCACCGCACATGGCTGCACCTGG 0: 1
1: 0
2: 4
3: 35
4: 296
Right 1069930610 10:71879016-71879038 GGCCATCTCCTCTGATGTAAAGG 0: 1
1: 0
2: 1
3: 14
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069930605 Original CRISPR CCAGGTGCAGCCATGTGCGG TGG (reversed) Intergenic
900126899 1:1072760-1072782 CCCGGTGCAGCCATGTGATGGGG - Intronic
900527738 1:3137281-3137303 CCGGGTGCAGGCATGTGAGGTGG + Intronic
900538078 1:3188742-3188764 CGGGGGGCAGCCATGTGCGTCGG + Intronic
900593497 1:3470060-3470082 GCAGCTGCAGCCATGCACGGGGG + Intronic
900798575 1:4724197-4724219 CCAGGCGGAACCATGGGCGGTGG + Intronic
902345480 1:15813857-15813879 CCAGGTGTGGCCAGGCGCGGTGG + Intergenic
902501810 1:16915889-16915911 CCATGAGCAGCCAGGTGTGGTGG + Intronic
902515088 1:16985847-16985869 CCAGGGGCAGACACGTGCAGGGG + Intergenic
902649825 1:17829842-17829864 CCAGGGGCAGCCAGGTGCAGAGG + Intergenic
902678538 1:18026775-18026797 CCAGTTGGGGCCAGGTGCGGTGG - Intergenic
903207096 1:21790768-21790790 CCAGGTGAGGCCAGGTGCGGTGG + Intergenic
903497044 1:23776172-23776194 CTAGGTACAGCCAGGTGTGGTGG - Intergenic
904157223 1:28494367-28494389 CAAGGTGCAGCCAGGCGCAGTGG + Intronic
904236881 1:29122255-29122277 TACGGTGCAGCCACGTGCGGGGG - Intronic
906153049 1:43598910-43598932 CCAGGTGCAGCATTGGGTGGTGG + Exonic
906330999 1:44884124-44884146 CCACTGGCAGCCAGGTGCGGTGG - Intronic
906663086 1:47596388-47596410 CCAGGCCCAGCCAGGTGAGGTGG - Intergenic
908493329 1:64668363-64668385 CCAGGTTCAGCCAAATGCAGTGG + Intronic
911115432 1:94241326-94241348 TCAAATGCAGCCAGGTGCGGTGG + Intronic
912499303 1:110111459-110111481 GCAGGTTCGGCCAGGTGCGGTGG + Intergenic
913230630 1:116737949-116737971 TGAGGTGCAGCCAGGTGCCGTGG - Intergenic
917798312 1:178548040-178548062 CAAGGTGCAGCTATTTGCAGAGG + Intronic
919594526 1:199545708-199545730 CAAGGTGCAGCCATCTACAGTGG + Intergenic
919646499 1:200099877-200099899 CCAGGTGTGGCCAGGCGCGGTGG - Intronic
920460054 1:206132474-206132496 CCATGTGCAGCCATTTCCAGGGG - Intergenic
920950854 1:210570516-210570538 CCAGAGGCAGCCATGTGCCCAGG + Intronic
923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG + Intronic
923201697 1:231718721-231718743 AAAGTTGCAGCCAGGTGCGGTGG - Intronic
1062845916 10:705020-705042 CGAAGTGAAGCCAGGTGCGGTGG + Intergenic
1063365703 10:5488985-5489007 CCAGCTGCAGCCACGTGAGAGGG + Intergenic
1063858179 10:10278582-10278604 TCTGGTGCAGCCATGTGGAGAGG - Intergenic
1063925400 10:10972683-10972705 CCAGGAGCAGCCAGGTGAGGAGG - Intergenic
1064309890 10:14202686-14202708 CCAGGTGTAGCCAGTCGCGGTGG - Intronic
1064918237 10:20486430-20486452 CCACATGCAGCCATGGGCCGCGG - Intergenic
1069930605 10:71878994-71879016 CCAGGTGCAGCCATGTGCGGTGG - Intergenic
1072050438 10:91698565-91698587 CCAGGGGCAGGCTTGTGTGGGGG + Intergenic
1072499822 10:96002890-96002912 CCGGGTCCAGCCAAGTGTGGTGG + Intronic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1072908837 10:99481971-99481993 CCAGGCGTAGCCGGGTGCGGTGG + Intergenic
1075646085 10:124097457-124097479 CCAGGTGCAGCCCTTTTCAGTGG - Intergenic
1075710908 10:124530101-124530123 CCTGGTGAAGCCAGGAGCGGTGG + Intronic
1077034231 11:487183-487205 CCTGGTGCAGAGATGTGCTGAGG + Intronic
1077181339 11:1218598-1218620 CCTGGTGCTGCCATGGGCAGTGG - Intergenic
1077420428 11:2447441-2447463 CCAGGTACCTCCATGTGGGGTGG + Intronic
1078345438 11:10544059-10544081 CCAGGTGCTGGCATGGGCGCTGG + Intergenic
1078549323 11:12269539-12269561 CCAGAGGGAGCCATGTGCTGAGG + Intergenic
1081909736 11:46693282-46693304 AAAAGTGCAGCCAGGTGCGGTGG - Intronic
1082739326 11:56893077-56893099 GCAGGTGCAGCCATGGGCCTGGG - Intergenic
1083029349 11:59577776-59577798 CCATCAGCAGCCAGGTGCGGTGG - Intronic
1083613563 11:64015643-64015665 CCTGGTGCAGAGATGTGGGGAGG + Intronic
1084326369 11:68402705-68402727 CCAGGTGCAGCAATGGGCGGAGG - Intronic
1084620778 11:70269108-70269130 CCAGGTGAGGCCGGGTGCGGTGG - Intergenic
1084733208 11:71087914-71087936 TCAAATGCAGCCAGGTGCGGTGG - Intronic
1085725487 11:78951228-78951250 CCATGGGCAGCCATGTGCATTGG - Intronic
1086318538 11:85619544-85619566 ACATGTGCAGCCATATGCAGTGG + Intronic
1086448199 11:86889979-86890001 CCAGTTGAGGCCAGGTGCGGTGG + Intronic
1087461175 11:98450256-98450278 CCAGGAGCAGCAATGTGCAAGGG + Intergenic
1087851227 11:103032440-103032462 CCAGTTGCAGCCGGGCGCGGTGG + Intergenic
1088801021 11:113307222-113307244 TTAGGTGCAGCCAGGTGCGGAGG - Intergenic
1089589910 11:119533528-119533550 CCAGCTCCAGCCATGGGAGGGGG + Intergenic
1090400454 11:126445345-126445367 CCAGGCGCAGCCCTGTGGGCTGG + Intronic
1091721444 12:2816931-2816953 CCAGGTGAGGCCAGGTGCAGTGG - Intronic
1092859713 12:12710062-12710084 CCACATGCAGCCAGGTGCGGTGG + Intergenic
1094605503 12:31945577-31945599 GAAGGTACAGCCAGGTGCGGTGG - Intergenic
1094635881 12:32226964-32226986 CCAGGGGAAGGCATGTGAGGAGG + Intronic
1096092554 12:48912848-48912870 CCAGGTTCTGCCAGGGGCGGTGG + Intronic
1096666766 12:53171346-53171368 CCAGGGGCGGCAGTGTGCGGAGG + Exonic
1102470699 12:113158277-113158299 CCAGCTGCAACCATGTCCAGTGG + Exonic
1102967808 12:117141500-117141522 GCTGCTGCAGCCATCTGCGGTGG + Intergenic
1103323832 12:120107272-120107294 TCAGGTTCAGCCGGGTGCGGTGG - Intronic
1104117525 12:125764140-125764162 CTGGCTGCAGCCAGGTGCGGCGG + Intergenic
1105600061 13:21878726-21878748 CCATCTGCAGCCCTGTGCCGGGG + Intergenic
1105634436 13:22203710-22203732 CCAGGTGCTTCCATTTGCTGAGG + Intergenic
1106135788 13:26972407-26972429 GCAGGTGAGGCCATCTGCGGAGG + Intergenic
1106256395 13:28026061-28026083 CAAGGCTCAGCCAGGTGCGGTGG + Intronic
1106694835 13:32162380-32162402 TTATGTGCAGCCATGTGGGGTGG - Intronic
1107816179 13:44246536-44246558 TCACGTGCATCCATGTGAGGGGG - Intergenic
1108531567 13:51331688-51331710 CCAGGTGATGCCATGGGCTGTGG - Intergenic
1108557824 13:51613043-51613065 GAAGCTGCAGCCATGTGCGGTGG + Intronic
1110533284 13:76621723-76621745 CCAGGTGCAAACATCTGAGGAGG + Intergenic
1111842840 13:93472472-93472494 CCAGGTGCCGGCATGGGCGCCGG + Intronic
1112511548 13:100013836-100013858 TCAGTTGCAGCCAAGTGTGGTGG + Intergenic
1112578658 13:100659695-100659717 CCACTTGAAGCAATGTGCGGTGG + Intronic
1112802979 13:103132843-103132865 GCAGGTGCAGCCAGGCACGGTGG - Intergenic
1113309467 13:109116759-109116781 CTAGGTGCAGCCATAGGCTGGGG - Intronic
1114674404 14:24430877-24430899 CCAGCTGCAGCCAGATGTGGGGG - Exonic
1119879667 14:78090407-78090429 CCAAGTCCAGCCATGTGCAAGGG + Intergenic
1120196980 14:81495349-81495371 CCATTTGCGGCCAGGTGCGGTGG + Intronic
1121651907 14:95564911-95564933 CCAGGTGTGGCCAGGTGTGGTGG + Intergenic
1121912973 14:97809034-97809056 CCAGGTGGGGCCAGGTGTGGTGG - Intergenic
1122072609 14:99214263-99214285 CCAGGTGTGGCCAGGTGTGGTGG + Intronic
1122514076 14:102294157-102294179 CCAGGTGAGGCCGGGTGCGGTGG + Intronic
1122724356 14:103740427-103740449 CACGGTGCTGCCATCTGCGGGGG + Exonic
1125712455 15:41797961-41797983 ACAGGTTCAGCCGGGTGCGGTGG + Intronic
1125727842 15:41877127-41877149 CCAGGTGCAGCCAGGCCTGGTGG + Exonic
1126039800 15:44578866-44578888 CCAGATGCAGCCAGTTGTGGCGG + Intronic
1128083816 15:64872536-64872558 CCAGGGGTAGCCAGGTGCAGTGG + Intronic
1129340572 15:74883206-74883228 TTAGCTGCAGCCAGGTGCGGTGG + Intergenic
1129725139 15:77897827-77897849 CCAGGTGCAGCCCTGTGCTGCGG - Intergenic
1130273196 15:82463033-82463055 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130331661 15:82926869-82926891 CAAGGTGCAGGCATTTGGGGAGG - Intronic
1130465548 15:84190404-84190426 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130487144 15:84404416-84404438 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130498717 15:84483132-84483154 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130587837 15:85194999-85195021 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130807518 15:87341426-87341448 ACAACTGCAGCCAGGTGCGGTGG - Intergenic
1131008667 15:88999353-88999375 CCAGGTGGAGCCATGGGCATCGG + Intergenic
1131146488 15:90017048-90017070 CCAGCTGCTGCCAGGTGCTGAGG + Intronic
1131395451 15:92081936-92081958 ACAGGTGCAGTAATGTGGGGAGG + Intronic
1131664175 15:94552443-94552465 CCAAAGGCAGCCATGTGGGGAGG - Intergenic
1132285327 15:100658401-100658423 ACAGGGGCACCCATGTGCGGCGG - Intergenic
1132685733 16:1161366-1161388 CCAGGTGCAGACAGCTGGGGAGG - Intronic
1132945006 16:2527762-2527784 CCAGGTGCAGCCCTGGGAGGAGG - Exonic
1132967664 16:2667928-2667950 CCAGGAGCAGGCAACTGCGGAGG + Intergenic
1133936684 16:10275138-10275160 CCGGGTGAGGCCAGGTGCGGTGG + Intergenic
1134044554 16:11091649-11091671 TCAGGTTAAGCCATGTGCTGAGG - Intronic
1134314948 16:13110160-13110182 TCAGTTGCAGCCATGTGTGGAGG - Intronic
1135670779 16:24373802-24373824 ACACATGCAGCCAGGTGCGGTGG + Intergenic
1135947554 16:26878060-26878082 CCAGATGCAGCCGGGGGCGGTGG + Intergenic
1136021546 16:27443494-27443516 GAAGGTCCAGCCAGGTGCGGTGG + Intronic
1138150057 16:54648633-54648655 CCAGGAACAGCCATTAGCGGAGG - Intergenic
1138601830 16:58060236-58060258 GCAGGTGGAGCCAGGCGCGGTGG - Intergenic
1139588396 16:67919065-67919087 CAAGGAGCAGCCATGTGAGCAGG + Intronic
1139912254 16:70405252-70405274 CCAGGCACAGCCTGGTGCGGTGG + Intronic
1140151073 16:72366515-72366537 CCAGGTATAGCCATGTGATGAGG - Intergenic
1141160890 16:81628373-81628395 CCAGCTGCAGCCTTGTGCTAAGG - Intronic
1141438249 16:84013153-84013175 CCAGGGGCACCCATGGGCGGAGG - Intronic
1141464916 16:84199020-84199042 CCAGCTGCAGCCCTGGGTGGTGG - Intergenic
1142068919 16:88078668-88078690 CCAAGTGAAGCCACGTGCAGAGG + Intronic
1142224510 16:88871093-88871115 CCATGTGCAGCCTGGTGGGGAGG - Intergenic
1142264166 16:89055943-89055965 CACTGTACAGCCATGTGCGGTGG + Intergenic
1142376341 16:89708860-89708882 GCAGCTGCAGCGATGGGCGGGGG + Exonic
1142425767 16:90001524-90001546 CCAGGGGCAGCCACGTGCTGGGG - Intergenic
1142692297 17:1613954-1613976 CCAGGTGAAGCCAGGCGCGGTGG + Intronic
1142841488 17:2634874-2634896 CCAAGTCCAGCCAGGTGTGGTGG + Intronic
1143634542 17:8156813-8156835 GCAGGCGCAGCCGTGAGCGGTGG + Intronic
1144075717 17:11717536-11717558 CCAGGCGGGGCCATGTGAGGGGG - Intronic
1145915799 17:28573364-28573386 CCAGGTGCAGCAATGAGAGAGGG + Exonic
1146974867 17:37102487-37102509 CTGGATGCAGCCAGGTGCGGTGG - Intronic
1147294794 17:39473601-39473623 CCGGGTGTGGCCAGGTGCGGTGG + Intronic
1147833219 17:43311769-43311791 CCAAATGCAGCCAGGTGCGGTGG - Intergenic
1148098488 17:45071884-45071906 ACAGGTCCAGCCAGGTGTGGTGG - Intronic
1148564689 17:48625966-48625988 CCGGCTCCAGCCAGGTGCGGAGG + Exonic
1148736953 17:49870260-49870282 CCAGGAGAAGCCATGTCTGGGGG + Intergenic
1150149365 17:62796699-62796721 CAATGTGCAGCCGGGTGCGGTGG + Intronic
1150551449 17:66214344-66214366 CCAGATGAGGCCAGGTGCGGTGG - Intronic
1151460199 17:74249795-74249817 GCAGCTGCAGCCAGGTGGGGGGG + Intronic
1152098104 17:78284505-78284527 CCAGATACAGCCAGGTGCGGTGG + Intergenic
1153038958 18:792671-792693 GCAGCAGCAGCCATGTGCAGTGG + Intronic
1154092255 18:11376576-11376598 CCAGGTTCTGCCATGTGAGGTGG - Intergenic
1155756031 18:29497691-29497713 AAAGTTACAGCCATGTGCGGTGG - Intergenic
1157483085 18:48068424-48068446 CAAGGCTCAGCCAGGTGCGGTGG - Intronic
1157831302 18:50859314-50859336 CATGGAGCAGCCAGGTGCGGTGG - Intergenic
1158387967 18:57016076-57016098 CCACGTGCAGCCAACTGGGGAGG + Intronic
1158497247 18:57967661-57967683 CAAGGTGCAGCCAGGAGAGGTGG + Intergenic
1160659691 19:292141-292163 CCAGGCGCAGCCCTGTGCCCAGG + Intergenic
1160663272 19:311380-311402 GCAGGTGCTGCCAAGTGCCGGGG - Intronic
1161645707 19:5452043-5452065 CCAGGTGCGGCCGGGCGCGGTGG + Intergenic
1161922276 19:7275493-7275515 TCAGTTTCAGCCAGGTGCGGTGG + Intronic
1161991021 19:7684256-7684278 CCAGGAGGGGCCACGTGCGGTGG + Exonic
1162218141 19:9153448-9153470 CCAGTTCCAGCCAGGTGCAGTGG - Intronic
1162561104 19:11418662-11418684 CCGGGGGCAGCCAGGTGAGGAGG - Exonic
1162707114 19:12563349-12563371 CCAGGTGGGGCCAGGTGCAGTGG + Intronic
1163241583 19:16067159-16067181 CCCGGTGCTGCAATGTGGGGAGG - Intronic
1163335744 19:16670649-16670671 CCATGTCCAGCCGGGTGCGGGGG + Intronic
1163390226 19:17026428-17026450 CCAGGTCCAGCCCAGCGCGGAGG + Intronic
1163546144 19:17942491-17942513 CCCGGTGCTGCCCTGGGCGGGGG - Intronic
1163772823 19:19201084-19201106 CCAGGTGCAGCCGGGTGTGGTGG - Intronic
1164230027 19:23279060-23279082 ACAGATGTAGCCAGGTGCGGTGG - Intergenic
1164306806 19:24011185-24011207 CCAGGTGAGGCCAGGTGCCGTGG + Intergenic
1164598843 19:29547847-29547869 CCTGCTGCAGCCATGTGCTCTGG - Intronic
1165722813 19:38091646-38091668 CCAGAGGCAGCCGAGTGCGGCGG - Intronic
1165808080 19:38594192-38594214 CCAAGAGCAGCCAGGTGCAGTGG + Intronic
1165879627 19:39032704-39032726 CCAGGTGCAGCCAGGAGCCAAGG + Intronic
1167131403 19:47588428-47588450 CCAGGTGGGGCCAGGTGCAGTGG + Intergenic
1167274184 19:48525809-48525831 GCAGATCCAGCCATGTGCAGTGG - Intergenic
1167800654 19:51739178-51739200 CCAGAAGCAGCCAAGTGCAGTGG - Intergenic
1168210166 19:54884342-54884364 CCAGTTGCAGCCAGGTGCGGTGG + Intronic
925345050 2:3166077-3166099 CCAGTTTCAGCCAGGTGCAGTGG - Intergenic
926157504 2:10465245-10465267 TCAGGTTCTGCCAGGTGCGGTGG - Intergenic
928032023 2:27788416-27788438 CCAACTGCAGCCAGGCGCGGTGG + Intronic
928537524 2:32254903-32254925 CCAGGAGCGGCCAGGTGCGGTGG - Intronic
929613725 2:43291695-43291717 CCACATGCAGACATGTGTGGAGG - Exonic
929790615 2:45019916-45019938 GCATGTGGAGCCAGGTGCGGTGG - Intergenic
931493661 2:62778247-62778269 CCAGGTCCAGCCATCTGCCTTGG - Intronic
931735026 2:65186202-65186224 CCGGGTGCGGCCAGGCGCGGCGG - Intergenic
932471510 2:71962470-71962492 CCAGCTGAAGCCATGTGGAGCGG - Intergenic
934570889 2:95372679-95372701 CCAGGTGCAGGCAGGTGGGTAGG + Intronic
937696758 2:124816763-124816785 CAAGCTGCAGCCATGCACGGTGG - Intronic
937930687 2:127202879-127202901 CCAGTTTCAGCCAGGTGCAGTGG + Intronic
938790485 2:134671506-134671528 GCAGCAGCAGCCATGTGCAGAGG - Intronic
938824408 2:134990905-134990927 GCTACTGCAGCCATGTGCGGTGG + Intronic
942212685 2:173687548-173687570 CCATGTGCAGACATGTGTGAGGG - Intergenic
944604998 2:201344821-201344843 GCAGGTGGTGCCATGTGCAGTGG + Intronic
948927267 2:241107309-241107331 CCAAGTGAAGTCATGTGGGGTGG + Intronic
1170845237 20:19956735-19956757 TCAGCTGCAGCCATATGGGGTGG - Exonic
1173930395 20:46812882-46812904 CATGGGGCAGCCAGGTGCGGTGG - Intergenic
1174121005 20:48265507-48265529 CCAGGTGGAGCGATATGGGGAGG - Intergenic
1174139902 20:48405578-48405600 CCAGGTGCTGCCATAGGCGCTGG + Intergenic
1174248512 20:49200309-49200331 ACAGGAGCGGCCAGGTGCGGTGG + Intergenic
1174309933 20:49644371-49644393 TCAGCTGCAGCCAGGTGCAGGGG - Intronic
1174382247 20:50163577-50163599 CCAGGTCCGGCCGGGTGCGGTGG - Intergenic
1174643574 20:52066408-52066430 CCAGGTGTGGCCAGGCGCGGTGG + Intronic
1175751939 20:61504585-61504607 CCAGGCGCAGACACGTGTGGTGG + Intronic
1175996413 20:62814093-62814115 CCTGGTGGAGCAATGTGAGGCGG - Intergenic
1176044547 20:63085561-63085583 CCAGGTGCACCCAAGGGCGGTGG - Intergenic
1176181955 20:63753644-63753666 CCCGGTGCACGCATGTGCCGAGG + Intronic
1176208635 20:63905542-63905564 CCATGTGCGGTCATGTGTGGTGG - Intronic
1178546967 21:33500500-33500522 CCAGGTGTGGCTATGTGCGGTGG - Intergenic
1179263719 21:39783028-39783050 CCAGGCTCATCCATGTGCTGTGG + Intronic
1179334109 21:40433978-40434000 CCAGGTGAAACCATGTGGTGTGG - Intronic
1181332385 22:22103355-22103377 GCAGATGCAGCCATGTGAGTTGG + Intergenic
1181576713 22:23799969-23799991 CCAGGTGTAGCCGGGCGCGGTGG - Intronic
1181584764 22:23847078-23847100 CTGGGTTCAGCCAGGTGCGGTGG + Intergenic
1183082343 22:35464539-35464561 CCAGGTGCAGTTATGTGCCCTGG + Intergenic
1183192636 22:36331539-36331561 CCAGGTGCAGACTTCTGCTGGGG + Intronic
1183647977 22:39137634-39137656 CAAAATGCTGCCATGTGCGGTGG - Intronic
1184189191 22:42883716-42883738 CCAGCTGCGGCCAGGTGCGGTGG + Intronic
1184417656 22:44361604-44361626 CCAGGTACAGCCACATGTGGAGG - Intergenic
1184766099 22:46573343-46573365 CCAGGTGCTGCCATCTCTGGGGG + Intergenic
1184864167 22:47193149-47193171 CCAGCTGCCTCCATGTGCAGGGG + Intergenic
1185260831 22:49861947-49861969 CAGGGTGCAGGCCTGTGCGGGGG - Intronic
1185350550 22:50334676-50334698 CCTGCTGAAGCCAGGTGCGGTGG + Intergenic
950136220 3:10582842-10582864 CCAGCTGGAGCCATGTGGTGTGG - Intronic
952298495 3:32083351-32083373 ACAGGTGCAGACATGATCGGGGG - Intergenic
953528911 3:43720834-43720856 CCAGGTAAAGCCATGTATGGCGG - Intronic
953900210 3:46836074-46836096 CAAGTGGCAGCCAGGTGCGGTGG + Intergenic
953926167 3:46983593-46983615 CCAGATAAAGCCAGGTGCGGTGG - Intronic
954208145 3:49075954-49075976 CCAGGTGTGGCCGGGTGCGGTGG + Intronic
954269679 3:49497872-49497894 CCAGGTGCAGACATGTTCTAGGG - Intronic
955242819 3:57194436-57194458 CCAGGAGCTGCCTTGTGCTGTGG + Intergenic
955333231 3:58064723-58064745 CCAGTTCCAGCCAGGTGCAGTGG + Intronic
955691971 3:61599779-61599801 GCAGGATCAGCCAGGTGCGGTGG - Intronic
955881592 3:63552183-63552205 CCAGATGCGGCCGGGTGCGGTGG - Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
956642313 3:71426773-71426795 TCAGATGCAGCCAGGCGCGGTGG + Intronic
956916319 3:73875542-73875564 CCAGGTGCTGGCATTTGGGGAGG + Intergenic
959120650 3:102228277-102228299 CCATATGTAGCCATGTGCGTAGG - Intronic
959904408 3:111694617-111694639 CCAGGTACAGCCATGTTGAGGGG - Intronic
961074338 3:123967706-123967728 GCAGGTGCAGCCCAGTGCTGTGG + Intergenic
962799495 3:138878157-138878179 CCAGGTGTGGCCAGGTGCGGTGG - Intergenic
965309887 3:167115572-167115594 CCATGGGCAGCCATGGGCGGTGG + Intergenic
966402632 3:179563081-179563103 CCGGCAGCAGCCATGAGCGGCGG + Exonic
966691086 3:182742381-182742403 GCAGGGTCAGCCAGGTGCGGTGG + Intergenic
967127790 3:186441100-186441122 CCAGGAGAAGCCAAGTGGGGTGG - Intergenic
968966661 4:3772349-3772371 GGAGGAGCAGCCCTGTGCGGAGG + Intergenic
968973721 4:3810382-3810404 CCAGGGCCAGGCATGTGCTGGGG + Intergenic
970993211 4:22236634-22236656 CCAGGTGAAGCCAGGTACAGTGG - Intergenic
972930926 4:44071047-44071069 CCAGGTGCTGGCATGGGCGCTGG + Intergenic
975639955 4:76490540-76490562 CCAGAAGCAGCCGGGTGCGGTGG - Intronic
976264759 4:83180069-83180091 CCAGGACCAGCCAGGCGCGGTGG - Intergenic
976804811 4:89035069-89035091 CCAGCTGCATCCATGTCCAGAGG - Intronic
977296824 4:95219262-95219284 TCAGCTGCAGCCATGTACAGAGG - Exonic
980738386 4:136918905-136918927 CCAGGTGCTGACATGTGTGCTGG - Intergenic
982693298 4:158571917-158571939 CCAGGTAAAGCCATGTGTGCAGG + Intronic
983228799 4:165109650-165109672 CCAGGTCTGGCCAGGTGCGGTGG - Intronic
984927704 4:184820866-184820888 CCAGGTTAGGCCAGGTGCGGTGG - Intronic
985111748 4:186553993-186554015 CCTAGTGCAGCCTTGTGCTGTGG - Intronic
985776303 5:1844770-1844792 ACAGGTGGAGCTATGTGCGTAGG - Intergenic
986187680 5:5459994-5460016 CCCGGTACAGCCTTGTGCAGGGG - Intronic
986691200 5:10315383-10315405 CCAGAGCCAGCCATGAGCGGAGG + Intergenic
988608647 5:32704204-32704226 CCAGCAGCAGCCATGTGGTGTGG - Intronic
990787604 5:59439862-59439884 CTAGGTGCAGGCATGGGCAGTGG + Intronic
991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG + Intergenic
997567676 5:134902135-134902157 ACTGGTGCTGCCAGGTGCGGGGG + Intergenic
998470057 5:142376667-142376689 CAAGGTGGGGCCGTGTGCGGTGG + Intergenic
999244652 5:150147424-150147446 CCCGGAGCAGCCATGGGCTGGGG + Intronic
1002537018 5:179881392-179881414 CCAGGTGCAGGCAGGTGGGCGGG - Intronic
1003087473 6:3071807-3071829 GCAGGTGCTGCTGTGTGCGGTGG - Intronic
1005050038 6:21676136-21676158 CCAGGTGTGGCCAGGTGTGGTGG - Intergenic
1005060776 6:21775304-21775326 ACAGGGTCAGCCAGGTGCGGTGG + Intergenic
1005265448 6:24107616-24107638 TCAGCTGCAGCCATGGGCAGTGG - Intergenic
1005647960 6:27860010-27860032 CCAGATGCGGCCAGGTGCGGTGG + Intronic
1007168674 6:39847117-39847139 CCAGGTGGGGCCATGTGCACAGG + Intronic
1012468086 6:99537791-99537813 CCAGGTGTGGCCAGGCGCGGTGG - Intergenic
1015302988 6:131675538-131675560 TCAAGTCCAGCCAGGTGCGGTGG + Intronic
1015965585 6:138693065-138693087 CCAGGGGCAGCTCTGGGCGGCGG + Intergenic
1016413899 6:143813330-143813352 TCAGATGCAGCCGGGTGCGGTGG + Intronic
1018511847 6:164532782-164532804 CCAGCTGCAGTCATGGGGGGAGG + Intergenic
1018836392 6:167487406-167487428 TCAGGTGCAGCTCTGTGAGGTGG + Intergenic
1019568900 7:1699348-1699370 CAAGTTGCAGCCAGGTGCAGTGG + Intronic
1019596624 7:1861287-1861309 CCAGGTGGAGCCATGTGCCCAGG - Intronic
1019690930 7:2411367-2411389 CCAGGCTCAGCCAGGTGCAGTGG - Intronic
1020123901 7:5521843-5521865 CCAGGTGAGGCCGGGTGCGGCGG + Intergenic
1020244293 7:6418949-6418971 GTAGTTGCAGCCAGGTGCGGTGG - Intronic
1020344240 7:7145795-7145817 TCACCTGCAGCCAGGTGCGGTGG + Intergenic
1021600105 7:22356601-22356623 TCAGGTGCAGCCTGGTGGGGGGG + Intronic
1023522512 7:41062361-41062383 CCCGGTGCAGCCGGGCGCGGTGG - Intergenic
1023646154 7:42318228-42318250 CCAGCAGCAGCCATGTGGTGTGG + Intergenic
1024008123 7:45242196-45242218 CCAGGTGCAGAAATGTGCAGTGG + Intergenic
1027000347 7:74648651-74648673 GCATTTGCAGCCAGGTGCGGTGG - Intergenic
1029121878 7:98273755-98273777 TCAAGAGCAGCCAGGTGCGGTGG - Intronic
1029889059 7:103907128-103907150 CCAGGCACAGCCAGGCGCGGTGG + Intronic
1032170852 7:129583366-129583388 GTAGGTACAGCCAGGTGCGGTGG - Intergenic
1033259037 7:139826337-139826359 CCAGGAGCAGCCAGATGGGGTGG + Intronic
1033323318 7:140359490-140359512 CCAGGTGCTGCTATGGGCAGAGG + Intronic
1034165588 7:149022742-149022764 GCAGGCACAGCCATGTGGGGTGG - Intronic
1034212456 7:149375961-149375983 CCAGGTGCCGGCAGGTGTGGAGG - Intergenic
1035277523 7:157757010-157757032 CCAGGAGCCGCCGTGTGGGGTGG + Intronic
1035411379 7:158645418-158645440 CCAGGAGTAGCCAAGTGCAGGGG + Intronic
1035721216 8:1794491-1794513 CCAGGAGCAGCCAGGTGCGGTGG - Intergenic
1037337071 8:17801643-17801665 CGCGGTGCAGCCAGGTGCGCCGG - Intergenic
1037778294 8:21849849-21849871 CCAGGATCAGCCATGGGCAGAGG + Intergenic
1041392990 8:57363821-57363843 CCAGATTGAGCCAGGTGCGGTGG - Intergenic
1042898263 8:73694751-73694773 CCAGCAGCAGCCATGTGGCGTGG + Intronic
1045278597 8:100728945-100728967 CCAGGTTCAGCCAGGAGCAGTGG - Intergenic
1046891892 8:119431139-119431161 CCATGTCCAGCCAGGTGCGGTGG + Intergenic
1047745022 8:127838415-127838437 CAAGGTCTAGCCAGGTGCGGTGG + Intergenic
1048351109 8:133617293-133617315 CCAGGAGCAGCCAGGCGTGGTGG - Intergenic
1049032056 8:140045336-140045358 CCAAGTCCGGCCAGGTGCGGTGG + Intronic
1049422096 8:142521538-142521560 CCAGGGCCTGCCATGTGCTGTGG + Intronic
1049551566 8:143262159-143262181 CCAGGTGCAGGTCTGTGAGGAGG + Intronic
1049561988 8:143316598-143316620 CCAGGGGAAGCCAGGTGCTGGGG - Intronic
1049656775 8:143802546-143802568 CCAGCTTCAGCCATGGGCGCTGG + Intronic
1056224271 9:84480189-84480211 CCAGTGGCAGCCATGGGCTGTGG + Intergenic
1057566528 9:96170047-96170069 CCTGGTGCAGCCCTGTGGGCTGG - Intergenic
1058044966 9:100348624-100348646 CCAGATACAGCCAGGTGCCGTGG + Intronic
1058187738 9:101875235-101875257 CCAAATGCAGTCATGTGCAGGGG - Intergenic
1059737277 9:117114919-117114941 CCATTTCCAGCCATGTGAGGGGG + Intronic
1060437751 9:123609397-123609419 CCAGGTAGAGCCATCTGGGGAGG + Intronic
1060973181 9:127750440-127750462 CCAGGTGGGGCCAGGTGCGATGG - Intronic
1061152529 9:128837004-128837026 ACAGCTGCGGCCAGGTGCGGTGG + Intronic
1062511488 9:136908577-136908599 CCAGGAGTGGCCAGGTGCGGCGG + Intronic
1062531623 9:137003738-137003760 CCAGGATCAGCCAGGTGCTGTGG - Intergenic
1062593468 9:137286093-137286115 CAAGGTGAAGCCAGGTGCGGTGG - Intergenic
1186402098 X:9269497-9269519 CCAGGCACGGCCATGGGCGGTGG + Intergenic
1187286248 X:17906635-17906657 CCAGTTGAAGACATGTGCTGAGG + Intergenic
1190889921 X:54558942-54558964 CCAGGTGGGGCCACGTGCAGTGG - Intronic
1190999383 X:55644332-55644354 CCAGGTGCGGTCAGGCGCGGTGG + Intergenic
1192448736 X:71229503-71229525 CCAGGTACTGCCAGGTGCAGTGG + Intergenic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1197211386 X:123830937-123830959 CCCGGTGGGGCCAGGTGCGGTGG - Intergenic
1197751220 X:129964858-129964880 CCAGGTGAAGCCTTGTGTGTGGG + Intergenic
1198019733 X:132646157-132646179 CCAGGGCCAGCCTTGTGGGGTGG + Intronic
1199849024 X:151712058-151712080 CCAGGTGCACCCATTTGCTTGGG + Intergenic
1200043161 X:153384506-153384528 CTAGGTGCTGCGATGTGGGGTGG - Intergenic