ID: 1069931052

View in Genome Browser
Species Human (GRCh38)
Location 10:71881871-71881893
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069931049_1069931052 -7 Left 1069931049 10:71881855-71881877 CCTCTGGGGCTCAATCGATCCTG No data
Right 1069931052 10:71881871-71881893 GATCCTGCCCCCAAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069931052 Original CRISPR GATCCTGCCCCCAAGTGGCT GGG Intergenic
No off target data available for this crispr