ID: 1069932364

View in Genome Browser
Species Human (GRCh38)
Location 10:71891392-71891414
Sequence GTAGAGCTGGGAGTCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932364_1069932375 13 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932375 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
1069932364_1069932370 2 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932370 10:71891417-71891439 GGGAGAGAGACCCACAAATAGGG No data
1069932364_1069932369 1 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932369 10:71891416-71891438 AGGGAGAGAGACCCACAAATAGG No data
1069932364_1069932377 29 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data
1069932364_1069932373 12 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932373 10:71891427-71891449 CCCACAAATAGGGATAGAGAGGG No data
1069932364_1069932371 11 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932371 10:71891426-71891448 ACCCACAAATAGGGATAGAGAGG No data
1069932364_1069932376 28 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932376 10:71891443-71891465 GAGAGGGGTAAATGCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932364 Original CRISPR GTAGAGCTGGGAGTCCACAG AGG (reversed) Intergenic