ID: 1069932368

View in Genome Browser
Species Human (GRCh38)
Location 10:71891405-71891427
Sequence GTCTCTCTCCCTAGTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932368_1069932376 15 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932376 10:71891443-71891465 GAGAGGGGTAAATGCTTCAGTGG No data
1069932368_1069932379 27 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932379 10:71891455-71891477 TGCTTCAGTGGGTGAGTACAGGG No data
1069932368_1069932375 0 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932375 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
1069932368_1069932371 -2 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932371 10:71891426-71891448 ACCCACAAATAGGGATAGAGAGG No data
1069932368_1069932373 -1 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932373 10:71891427-71891449 CCCACAAATAGGGATAGAGAGGG No data
1069932368_1069932378 26 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932378 10:71891454-71891476 ATGCTTCAGTGGGTGAGTACAGG No data
1069932368_1069932377 16 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932368 Original CRISPR GTCTCTCTCCCTAGTAGAGC TGG (reversed) Intergenic
No off target data available for this crispr