ID: 1069932369

View in Genome Browser
Species Human (GRCh38)
Location 10:71891416-71891438
Sequence AGGGAGAGAGACCCACAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932363_1069932369 2 Left 1069932363 10:71891391-71891413 CCCTCTGTGGACTCCCAGCTCTA No data
Right 1069932369 10:71891416-71891438 AGGGAGAGAGACCCACAAATAGG No data
1069932364_1069932369 1 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932369 10:71891416-71891438 AGGGAGAGAGACCCACAAATAGG No data
1069932361_1069932369 28 Left 1069932361 10:71891365-71891387 CCTGGGAATTCAAGAGAGAATTA No data
Right 1069932369 10:71891416-71891438 AGGGAGAGAGACCCACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932369 Original CRISPR AGGGAGAGAGACCCACAAAT AGG Intergenic
No off target data available for this crispr