ID: 1069932370

View in Genome Browser
Species Human (GRCh38)
Location 10:71891417-71891439
Sequence GGGAGAGAGACCCACAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932361_1069932370 29 Left 1069932361 10:71891365-71891387 CCTGGGAATTCAAGAGAGAATTA No data
Right 1069932370 10:71891417-71891439 GGGAGAGAGACCCACAAATAGGG No data
1069932367_1069932370 -10 Left 1069932367 10:71891404-71891426 CCCAGCTCTACTAGGGAGAGAGA No data
Right 1069932370 10:71891417-71891439 GGGAGAGAGACCCACAAATAGGG No data
1069932363_1069932370 3 Left 1069932363 10:71891391-71891413 CCCTCTGTGGACTCCCAGCTCTA No data
Right 1069932370 10:71891417-71891439 GGGAGAGAGACCCACAAATAGGG No data
1069932364_1069932370 2 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932370 10:71891417-71891439 GGGAGAGAGACCCACAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932370 Original CRISPR GGGAGAGAGACCCACAAATA GGG Intergenic
No off target data available for this crispr