ID: 1069932371

View in Genome Browser
Species Human (GRCh38)
Location 10:71891426-71891448
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932367_1069932371 -1 Left 1069932367 10:71891404-71891426 CCCAGCTCTACTAGGGAGAGAGA No data
Right 1069932371 10:71891426-71891448 ACCCACAAATAGGGATAGAGAGG No data
1069932363_1069932371 12 Left 1069932363 10:71891391-71891413 CCCTCTGTGGACTCCCAGCTCTA No data
Right 1069932371 10:71891426-71891448 ACCCACAAATAGGGATAGAGAGG No data
1069932364_1069932371 11 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932371 10:71891426-71891448 ACCCACAAATAGGGATAGAGAGG No data
1069932368_1069932371 -2 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932371 10:71891426-71891448 ACCCACAAATAGGGATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932371 Original CRISPR ACCCACAAATAGGGATAGAG AGG Intergenic