ID: 1069932374

View in Genome Browser
Species Human (GRCh38)
Location 10:71891428-71891450
Sequence CCCCTCTCTATCCCTATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932374_1069932376 -8 Left 1069932374 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
Right 1069932376 10:71891443-71891465 GAGAGGGGTAAATGCTTCAGTGG No data
1069932374_1069932378 3 Left 1069932374 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
Right 1069932378 10:71891454-71891476 ATGCTTCAGTGGGTGAGTACAGG No data
1069932374_1069932379 4 Left 1069932374 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
Right 1069932379 10:71891455-71891477 TGCTTCAGTGGGTGAGTACAGGG No data
1069932374_1069932380 13 Left 1069932374 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
Right 1069932380 10:71891464-71891486 GGGTGAGTACAGGGCCTGCAAGG No data
1069932374_1069932377 -7 Left 1069932374 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932374 Original CRISPR CCCCTCTCTATCCCTATTTG TGG (reversed) Intergenic
No off target data available for this crispr