ID: 1069932377

View in Genome Browser
Species Human (GRCh38)
Location 10:71891444-71891466
Sequence AGAGGGGTAAATGCTTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932364_1069932377 29 Left 1069932364 10:71891392-71891414 CCTCTGTGGACTCCCAGCTCTAC No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data
1069932368_1069932377 16 Left 1069932368 10:71891405-71891427 CCAGCTCTACTAGGGAGAGAGAC No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data
1069932372_1069932377 -6 Left 1069932372 10:71891427-71891449 CCCACAAATAGGGATAGAGAGGG No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data
1069932363_1069932377 30 Left 1069932363 10:71891391-71891413 CCCTCTGTGGACTCCCAGCTCTA No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data
1069932374_1069932377 -7 Left 1069932374 10:71891428-71891450 CCACAAATAGGGATAGAGAGGGG No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data
1069932367_1069932377 17 Left 1069932367 10:71891404-71891426 CCCAGCTCTACTAGGGAGAGAGA No data
Right 1069932377 10:71891444-71891466 AGAGGGGTAAATGCTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932377 Original CRISPR AGAGGGGTAAATGCTTCAGT GGG Intergenic
No off target data available for this crispr