ID: 1069932410

View in Genome Browser
Species Human (GRCh38)
Location 10:71891647-71891669
Sequence CGCAGCATGCAGGCCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069932405_1069932410 -4 Left 1069932405 10:71891628-71891650 CCCAAGGAAAAGCAGAGCACGCA No data
Right 1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG No data
1069932402_1069932410 27 Left 1069932402 10:71891597-71891619 CCGCAGGCTGAGGATGCGGCATA No data
Right 1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG No data
1069932406_1069932410 -5 Left 1069932406 10:71891629-71891651 CCAAGGAAAAGCAGAGCACGCAG No data
Right 1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069932410 Original CRISPR CGCAGCATGCAGGCCCTGGA GGG Intergenic
No off target data available for this crispr