ID: 1069940844

View in Genome Browser
Species Human (GRCh38)
Location 10:71954247-71954269
Sequence GTGTAGTGGGTGGTGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069940838_1069940844 -6 Left 1069940838 10:71954230-71954252 CCTTCAGGTCAATTGTGGTGTAG No data
Right 1069940844 10:71954247-71954269 GTGTAGTGGGTGGTGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069940844 Original CRISPR GTGTAGTGGGTGGTGTTGGT GGG Intergenic
No off target data available for this crispr