ID: 1069942464

View in Genome Browser
Species Human (GRCh38)
Location 10:71964758-71964780
Sequence CGCCTGGACGCGGAAGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11846
Summary {0: 1, 1: 0, 2: 11, 3: 621, 4: 11213}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942464_1069942481 22 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942481 10:71964803-71964825 GAAGGGGGCGAAGCGGACGGTGG 0: 1
1: 0
2: 3
3: 8
4: 218
1069942464_1069942472 -3 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942472 10:71964778-71964800 GCGCGCGCGCCAGACTTTGGAGG 0: 1
1: 0
2: 2
3: 2
4: 20
1069942464_1069942474 4 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942474 10:71964785-71964807 CGCCAGACTTTGGAGGGAGAAGG 0: 1
1: 0
2: 2
3: 7
4: 161
1069942464_1069942471 -6 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942471 10:71964775-71964797 CAGGCGCGCGCGCCAGACTTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1069942464_1069942475 5 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942475 10:71964786-71964808 GCCAGACTTTGGAGGGAGAAGGG 0: 1
1: 0
2: 5
3: 34
4: 339
1069942464_1069942478 7 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942478 10:71964788-71964810 CAGACTTTGGAGGGAGAAGGGGG 0: 1
1: 0
2: 0
3: 47
4: 524
1069942464_1069942473 -2 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942473 10:71964779-71964801 CGCGCGCGCCAGACTTTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 11
1069942464_1069942477 6 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942477 10:71964787-71964809 CCAGACTTTGGAGGGAGAAGGGG 0: 1
1: 0
2: 1
3: 40
4: 396
1069942464_1069942480 19 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942480 10:71964800-71964822 GGAGAAGGGGGCGAAGCGGACGG 0: 1
1: 0
2: 3
3: 85
4: 862
1069942464_1069942484 29 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942484 10:71964810-71964832 GCGAAGCGGACGGTGGGAGGTGG 0: 1
1: 0
2: 0
3: 20
4: 250
1069942464_1069942483 26 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942483 10:71964807-71964829 GGGGCGAAGCGGACGGTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 242
1069942464_1069942479 15 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942479 10:71964796-71964818 GGAGGGAGAAGGGGGCGAAGCGG 0: 1
1: 0
2: 14
3: 208
4: 2047
1069942464_1069942482 23 Left 1069942464 10:71964758-71964780 CCCCCGCCTTCCGCGTCCAGGCG 0: 1
1: 0
2: 11
3: 621
4: 11213
Right 1069942482 10:71964804-71964826 AAGGGGGCGAAGCGGACGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942464 Original CRISPR CGCCTGGACGCGGAAGGCGG GGG (reversed) Intronic
Too many off-targets to display for this crispr