ID: 1069942526 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:71965023-71965045 |
| Sequence | TGAGGACGTGCCTGCTGTAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069942526_1069942528 | -1 | Left | 1069942526 | 10:71965023-71965045 | CCTCTACAGCAGGCACGTCCTCA | No data | ||
| Right | 1069942528 | 10:71965045-71965067 | ACACCCCTCCGTCACATCCACGG | No data | ||||
| 1069942526_1069942535 | 30 | Left | 1069942526 | 10:71965023-71965045 | CCTCTACAGCAGGCACGTCCTCA | No data | ||
| Right | 1069942535 | 10:71965076-71965098 | TGCTGCCCCCGCAGCCCCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069942526 | Original CRISPR | TGAGGACGTGCCTGCTGTAG AGG (reversed) | Intronic | ||