ID: 1069942526

View in Genome Browser
Species Human (GRCh38)
Location 10:71965023-71965045
Sequence TGAGGACGTGCCTGCTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942526_1069942528 -1 Left 1069942526 10:71965023-71965045 CCTCTACAGCAGGCACGTCCTCA No data
Right 1069942528 10:71965045-71965067 ACACCCCTCCGTCACATCCACGG No data
1069942526_1069942535 30 Left 1069942526 10:71965023-71965045 CCTCTACAGCAGGCACGTCCTCA No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942526 Original CRISPR TGAGGACGTGCCTGCTGTAG AGG (reversed) Intronic