ID: 1069942527 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:71965041-71965063 |
Sequence | GGATGTGACGGAGGGGTGTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1069942527_1069942539 | 18 | Left | 1069942527 | 10:71965041-71965063 | CCTCACACCCCTCCGTCACATCC | No data | ||
Right | 1069942539 | 10:71965082-71965104 | CCCCGCAGCCCCCAAGGAGAGGG | No data | ||||
1069942527_1069942537 | 17 | Left | 1069942527 | 10:71965041-71965063 | CCTCACACCCCTCCGTCACATCC | No data | ||
Right | 1069942537 | 10:71965081-71965103 | CCCCCGCAGCCCCCAAGGAGAGG | No data | ||||
1069942527_1069942535 | 12 | Left | 1069942527 | 10:71965041-71965063 | CCTCACACCCCTCCGTCACATCC | No data | ||
Right | 1069942535 | 10:71965076-71965098 | TGCTGCCCCCGCAGCCCCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1069942527 | Original CRISPR | GGATGTGACGGAGGGGTGTG AGG (reversed) | Intronic | ||