ID: 1069942527

View in Genome Browser
Species Human (GRCh38)
Location 10:71965041-71965063
Sequence GGATGTGACGGAGGGGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942527_1069942535 12 Left 1069942527 10:71965041-71965063 CCTCACACCCCTCCGTCACATCC No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942527_1069942539 18 Left 1069942527 10:71965041-71965063 CCTCACACCCCTCCGTCACATCC No data
Right 1069942539 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
1069942527_1069942537 17 Left 1069942527 10:71965041-71965063 CCTCACACCCCTCCGTCACATCC No data
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942527 Original CRISPR GGATGTGACGGAGGGGTGTG AGG (reversed) Intronic