ID: 1069942529

View in Genome Browser
Species Human (GRCh38)
Location 10:71965048-71965070
Sequence AGGCCGTGGATGTGACGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942529_1069942539 11 Left 1069942529 10:71965048-71965070 CCCCTCCGTCACATCCACGGCCT No data
Right 1069942539 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
1069942529_1069942537 10 Left 1069942529 10:71965048-71965070 CCCCTCCGTCACATCCACGGCCT No data
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942529_1069942535 5 Left 1069942529 10:71965048-71965070 CCCCTCCGTCACATCCACGGCCT No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942529_1069942546 30 Left 1069942529 10:71965048-71965070 CCCCTCCGTCACATCCACGGCCT No data
Right 1069942546 10:71965101-71965123 AGGGAGCCCCCAAAGCGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942529 Original CRISPR AGGCCGTGGATGTGACGGAG GGG (reversed) Intronic