ID: 1069942531

View in Genome Browser
Species Human (GRCh38)
Location 10:71965050-71965072
Sequence AAAGGCCGTGGATGTGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942531_1069942535 3 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942531_1069942546 28 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT No data
Right 1069942546 10:71965101-71965123 AGGGAGCCCCCAAAGCGCAGCGG No data
1069942531_1069942537 8 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT No data
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942531_1069942539 9 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT No data
Right 1069942539 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
1069942531_1069942547 29 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942531 Original CRISPR AAAGGCCGTGGATGTGACGG AGG (reversed) Intronic