ID: 1069942532

View in Genome Browser
Species Human (GRCh38)
Location 10:71965053-71965075
Sequence GACAAAGGCCGTGGATGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942532_1069942547 26 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942532_1069942546 25 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942546 10:71965101-71965123 AGGGAGCCCCCAAAGCGCAGCGG No data
1069942532_1069942539 6 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942539 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
1069942532_1069942535 0 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942532_1069942537 5 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942532_1069942548 30 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942532 Original CRISPR GACAAAGGCCGTGGATGTGA CGG (reversed) Intronic