ID: 1069942533

View in Genome Browser
Species Human (GRCh38)
Location 10:71965062-71965084
Sequence GGGGCAGCAGACAAAGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942533_1069942535 -9 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942533_1069942547 17 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942533_1069942548 21 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942533_1069942539 -3 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942539 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
1069942533_1069942546 16 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942546 10:71965101-71965123 AGGGAGCCCCCAAAGCGCAGCGG No data
1069942533_1069942537 -4 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942533_1069942553 28 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942553 10:71965113-71965135 AAGCGCAGCGGGCAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942533 Original CRISPR GGGGCAGCAGACAAAGGCCG TGG (reversed) Intronic