ID: 1069942535

View in Genome Browser
Species Human (GRCh38)
Location 10:71965076-71965098
Sequence TGCTGCCCCCGCAGCCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942530_1069942535 4 Left 1069942530 10:71965049-71965071 CCCTCCGTCACATCCACGGCCTT No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942527_1069942535 12 Left 1069942527 10:71965041-71965063 CCTCACACCCCTCCGTCACATCC No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942533_1069942535 -9 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942532_1069942535 0 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942531_1069942535 3 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942526_1069942535 30 Left 1069942526 10:71965023-71965045 CCTCTACAGCAGGCACGTCCTCA No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data
1069942529_1069942535 5 Left 1069942529 10:71965048-71965070 CCCCTCCGTCACATCCACGGCCT No data
Right 1069942535 10:71965076-71965098 TGCTGCCCCCGCAGCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942535 Original CRISPR TGCTGCCCCCGCAGCCCCCA AGG Intronic