ID: 1069942537

View in Genome Browser
Species Human (GRCh38)
Location 10:71965081-71965103
Sequence CCCCCGCAGCCCCCAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942529_1069942537 10 Left 1069942529 10:71965048-71965070 CCCCTCCGTCACATCCACGGCCT 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942530_1069942537 9 Left 1069942530 10:71965049-71965071 CCCTCCGTCACATCCACGGCCTT 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942533_1069942537 -4 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC 0: 1
1: 0
2: 0
3: 32
4: 277
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942527_1069942537 17 Left 1069942527 10:71965041-71965063 CCTCACACCCCTCCGTCACATCC 0: 1
1: 0
2: 6
3: 40
4: 348
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942532_1069942537 5 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942531_1069942537 8 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
1069942534_1069942537 -10 Left 1069942534 10:71965068-71965090 CCTTTGTCTGCTGCCCCCGCAGC 0: 1
1: 0
2: 1
3: 16
4: 244
Right 1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942537 Original CRISPR CCCCCGCAGCCCCCAAGGAG AGG Intronic
No off target data available for this crispr