ID: 1069942538

View in Genome Browser
Species Human (GRCh38)
Location 10:71965082-71965104
Sequence CCCTCTCCTTGGGGGCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942538_1069942548 1 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942538_1069942547 -3 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942538_1069942546 -4 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942546 10:71965101-71965123 AGGGAGCCCCCAAAGCGCAGCGG No data
1069942538_1069942553 8 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942553 10:71965113-71965135 AAGCGCAGCGGGCAGGAGAGAGG No data
1069942538_1069942554 16 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942554 10:71965121-71965143 CGGGCAGGAGAGAGGCTGCCTGG No data
1069942538_1069942555 17 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942555 10:71965122-71965144 GGGCAGGAGAGAGGCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942538 Original CRISPR CCCTCTCCTTGGGGGCTGCG GGG (reversed) Intronic