ID: 1069942547

View in Genome Browser
Species Human (GRCh38)
Location 10:71965102-71965124
Sequence GGGAGCCCCCAAAGCGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942533_1069942547 17 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942540_1069942547 -4 Left 1069942540 10:71965083-71965105 CCCGCAGCCCCCAAGGAGAGGGA No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942541_1069942547 -5 Left 1069942541 10:71965084-71965106 CCGCAGCCCCCAAGGAGAGGGAG No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942531_1069942547 29 Left 1069942531 10:71965050-71965072 CCTCCGTCACATCCACGGCCTTT No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942532_1069942547 26 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942538_1069942547 -3 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942536_1069942547 -2 Left 1069942536 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942530_1069942547 30 Left 1069942530 10:71965049-71965071 CCCTCCGTCACATCCACGGCCTT No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data
1069942534_1069942547 11 Left 1069942534 10:71965068-71965090 CCTTTGTCTGCTGCCCCCGCAGC No data
Right 1069942547 10:71965102-71965124 GGGAGCCCCCAAAGCGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942547 Original CRISPR GGGAGCCCCCAAAGCGCAGC GGG Intronic