ID: 1069942548

View in Genome Browser
Species Human (GRCh38)
Location 10:71965106-71965128
Sequence GCCCCCAAAGCGCAGCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069942544_1069942548 -9 Left 1069942544 10:71965092-71965114 CCCAAGGAGAGGGAGCCCCCAAA 0: 1
1: 0
2: 2
3: 14
4: 169
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942532_1069942548 30 Left 1069942532 10:71965053-71965075 CCGTCACATCCACGGCCTTTGTC No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942538_1069942548 1 Left 1069942538 10:71965082-71965104 CCCCGCAGCCCCCAAGGAGAGGG No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942534_1069942548 15 Left 1069942534 10:71965068-71965090 CCTTTGTCTGCTGCCCCCGCAGC No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942540_1069942548 0 Left 1069942540 10:71965083-71965105 CCCGCAGCCCCCAAGGAGAGGGA No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942536_1069942548 2 Left 1069942536 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942543_1069942548 -8 Left 1069942543 10:71965091-71965113 CCCCAAGGAGAGGGAGCCCCCAA No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942545_1069942548 -10 Left 1069942545 10:71965093-71965115 CCAAGGAGAGGGAGCCCCCAAAG No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942541_1069942548 -1 Left 1069942541 10:71965084-71965106 CCGCAGCCCCCAAGGAGAGGGAG No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942533_1069942548 21 Left 1069942533 10:71965062-71965084 CCACGGCCTTTGTCTGCTGCCCC No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data
1069942542_1069942548 -7 Left 1069942542 10:71965090-71965112 CCCCCAAGGAGAGGGAGCCCCCA No data
Right 1069942548 10:71965106-71965128 GCCCCCAAAGCGCAGCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069942548 Original CRISPR GCCCCCAAAGCGCAGCGGGC AGG Intronic