ID: 1069944956

View in Genome Browser
Species Human (GRCh38)
Location 10:71979310-71979332
Sequence CTCCAATTCTCACAAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069944956_1069944966 28 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944966 10:71979361-71979383 TTAGACGGAGTCTCGGGAGGGGG No data
1069944956_1069944965 27 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944965 10:71979360-71979382 TTTAGACGGAGTCTCGGGAGGGG No data
1069944956_1069944963 25 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944963 10:71979358-71979380 TTTTTAGACGGAGTCTCGGGAGG No data
1069944956_1069944962 22 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944962 10:71979355-71979377 GTTTTTTTAGACGGAGTCTCGGG No data
1069944956_1069944961 21 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944961 10:71979354-71979376 TGTTTTTTTAGACGGAGTCTCGG No data
1069944956_1069944964 26 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944964 10:71979359-71979381 TTTTAGACGGAGTCTCGGGAGGG No data
1069944956_1069944967 29 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944967 10:71979362-71979384 TAGACGGAGTCTCGGGAGGGGGG No data
1069944956_1069944960 13 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG No data
Right 1069944960 10:71979346-71979368 TTCTTTTTTGTTTTTTTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069944956 Original CRISPR CTCCAATTCTCACAAGAGCC TGG (reversed) Intronic