ID: 1069944966

View in Genome Browser
Species Human (GRCh38)
Location 10:71979361-71979383
Sequence TTAGACGGAGTCTCGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069944956_1069944966 28 Left 1069944956 10:71979310-71979332 CCAGGCTCTTGTGAGAATTGGAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1069944966 10:71979361-71979383 TTAGACGGAGTCTCGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069944966 Original CRISPR TTAGACGGAGTCTCGGGAGG GGG Intronic
No off target data available for this crispr