ID: 1069950357

View in Genome Browser
Species Human (GRCh38)
Location 10:72014462-72014484
Sequence CAGGTTAAGATTTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069950357_1069950367 9 Left 1069950357 10:72014462-72014484 CCCCCTCCCCAAATCTTAACCTG No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950357_1069950368 10 Left 1069950357 10:72014462-72014484 CCCCCTCCCCAAATCTTAACCTG No data
Right 1069950368 10:72014495-72014517 AGTTCACCCAGTCCAGGCTTGGG No data
1069950357_1069950365 4 Left 1069950357 10:72014462-72014484 CCCCCTCCCCAAATCTTAACCTG No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069950357 Original CRISPR CAGGTTAAGATTTGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr