ID: 1069950365

View in Genome Browser
Species Human (GRCh38)
Location 10:72014489-72014511
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069950357_1069950365 4 Left 1069950357 10:72014462-72014484 CCCCCTCCCCAAATCTTAACCTG No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data
1069950363_1069950365 -4 Left 1069950363 10:72014470-72014492 CCAAATCTTAACCTGTGTCTCTG No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data
1069950356_1069950365 5 Left 1069950356 10:72014461-72014483 CCCCCCTCCCCAAATCTTAACCT No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data
1069950359_1069950365 2 Left 1069950359 10:72014464-72014486 CCCTCCCCAAATCTTAACCTGTG No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data
1069950362_1069950365 -3 Left 1069950362 10:72014469-72014491 CCCAAATCTTAACCTGTGTCTCT No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data
1069950360_1069950365 1 Left 1069950360 10:72014465-72014487 CCTCCCCAAATCTTAACCTGTGT No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data
1069950361_1069950365 -2 Left 1069950361 10:72014468-72014490 CCCCAAATCTTAACCTGTGTCTC No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data
1069950358_1069950365 3 Left 1069950358 10:72014463-72014485 CCCCTCCCCAAATCTTAACCTGT No data
Right 1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069950365 Original CRISPR TCTGCCAGTTCACCCAGTCC AGG Intergenic
No off target data available for this crispr