ID: 1069950367

View in Genome Browser
Species Human (GRCh38)
Location 10:72014494-72014516
Sequence CAGTTCACCCAGTCCAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069950356_1069950367 10 Left 1069950356 10:72014461-72014483 CCCCCCTCCCCAAATCTTAACCT No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950361_1069950367 3 Left 1069950361 10:72014468-72014490 CCCCAAATCTTAACCTGTGTCTC No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950364_1069950367 -10 Left 1069950364 10:72014481-72014503 CCTGTGTCTCTGCCAGTTCACCC No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950359_1069950367 7 Left 1069950359 10:72014464-72014486 CCCTCCCCAAATCTTAACCTGTG No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950360_1069950367 6 Left 1069950360 10:72014465-72014487 CCTCCCCAAATCTTAACCTGTGT No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950357_1069950367 9 Left 1069950357 10:72014462-72014484 CCCCCTCCCCAAATCTTAACCTG No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950358_1069950367 8 Left 1069950358 10:72014463-72014485 CCCCTCCCCAAATCTTAACCTGT No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950362_1069950367 2 Left 1069950362 10:72014469-72014491 CCCAAATCTTAACCTGTGTCTCT No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data
1069950363_1069950367 1 Left 1069950363 10:72014470-72014492 CCAAATCTTAACCTGTGTCTCTG No data
Right 1069950367 10:72014494-72014516 CAGTTCACCCAGTCCAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069950367 Original CRISPR CAGTTCACCCAGTCCAGGCT TGG Intergenic
No off target data available for this crispr