ID: 1069952120

View in Genome Browser
Species Human (GRCh38)
Location 10:72026187-72026209
Sequence CTGTTGTTTAAAAGCACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069952109_1069952120 29 Left 1069952109 10:72026135-72026157 CCCGGTCCTCAGAGACTGATTTG No data
Right 1069952120 10:72026187-72026209 CTGTTGTTTAAAAGCACCCAGGG No data
1069952113_1069952120 23 Left 1069952113 10:72026141-72026163 CCTCAGAGACTGATTTGGTTGGT No data
Right 1069952120 10:72026187-72026209 CTGTTGTTTAAAAGCACCCAGGG No data
1069952110_1069952120 28 Left 1069952110 10:72026136-72026158 CCGGTCCTCAGAGACTGATTTGG No data
Right 1069952120 10:72026187-72026209 CTGTTGTTTAAAAGCACCCAGGG No data
1069952108_1069952120 30 Left 1069952108 10:72026134-72026156 CCCCGGTCCTCAGAGACTGATTT No data
Right 1069952120 10:72026187-72026209 CTGTTGTTTAAAAGCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069952120 Original CRISPR CTGTTGTTTAAAAGCACCCA GGG Intergenic
No off target data available for this crispr