ID: 1069952198

View in Genome Browser
Species Human (GRCh38)
Location 10:72026790-72026812
Sequence CTCTGCCAGGCCTCGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069952198_1069952208 7 Left 1069952198 10:72026790-72026812 CCTCCAGCCGAGGCCTGGCAGAG No data
Right 1069952208 10:72026820-72026842 GTGGGCTTCCAGCCCCCTGTGGG No data
1069952198_1069952207 6 Left 1069952198 10:72026790-72026812 CCTCCAGCCGAGGCCTGGCAGAG No data
Right 1069952207 10:72026819-72026841 TGTGGGCTTCCAGCCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069952198 Original CRISPR CTCTGCCAGGCCTCGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr