ID: 1069959459

View in Genome Browser
Species Human (GRCh38)
Location 10:72071078-72071100
Sequence CTTCTATGATTCAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069959451_1069959459 15 Left 1069959451 10:72071040-72071062 CCCCTGCAGCCTTCTAAGACTGC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG No data
1069959454_1069959459 6 Left 1069959454 10:72071049-72071071 CCTTCTAAGACTGCAACCCCATC 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG No data
1069959455_1069959459 -10 Left 1069959455 10:72071065-72071087 CCCCATCTTTCATCTTCTATGAT 0: 1
1: 0
2: 5
3: 37
4: 383
Right 1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG No data
1069959452_1069959459 14 Left 1069959452 10:72071041-72071063 CCCTGCAGCCTTCTAAGACTGCA 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG No data
1069959453_1069959459 13 Left 1069959453 10:72071042-72071064 CCTGCAGCCTTCTAAGACTGCAA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG No data
1069959450_1069959459 20 Left 1069959450 10:72071035-72071057 CCATGCCCCTGCAGCCTTCTAAG 0: 1
1: 0
2: 4
3: 62
4: 379
Right 1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG No data
1069959449_1069959459 24 Left 1069959449 10:72071031-72071053 CCGGCCATGCCCCTGCAGCCTTC 0: 1
1: 1
2: 6
3: 50
4: 492
Right 1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069959459 Original CRISPR CTTCTATGATTCAGGAAAGA AGG Intronic
No off target data available for this crispr