ID: 1069960066

View in Genome Browser
Species Human (GRCh38)
Location 10:72074216-72074238
Sequence CTTCAGAAGCCTGAAGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1055
Summary {0: 1, 1: 1, 2: 7, 3: 132, 4: 914}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069960066_1069960074 10 Left 1069960066 10:72074216-72074238 CCAAGGCCTTCAGGCTTCTGAAG 0: 1
1: 1
2: 7
3: 132
4: 914
Right 1069960074 10:72074249-72074271 AAGCTGGCAAGCGTCAGAGCAGG No data
1069960066_1069960078 28 Left 1069960066 10:72074216-72074238 CCAAGGCCTTCAGGCTTCTGAAG 0: 1
1: 1
2: 7
3: 132
4: 914
Right 1069960078 10:72074267-72074289 GCAGGCAGGGTGAGGCCTCCTGG No data
1069960066_1069960077 20 Left 1069960066 10:72074216-72074238 CCAAGGCCTTCAGGCTTCTGAAG 0: 1
1: 1
2: 7
3: 132
4: 914
Right 1069960077 10:72074259-72074281 GCGTCAGAGCAGGCAGGGTGAGG No data
1069960066_1069960075 14 Left 1069960066 10:72074216-72074238 CCAAGGCCTTCAGGCTTCTGAAG 0: 1
1: 1
2: 7
3: 132
4: 914
Right 1069960075 10:72074253-72074275 TGGCAAGCGTCAGAGCAGGCAGG No data
1069960066_1069960069 -6 Left 1069960066 10:72074216-72074238 CCAAGGCCTTCAGGCTTCTGAAG 0: 1
1: 1
2: 7
3: 132
4: 914
Right 1069960069 10:72074233-72074255 CTGAAGCCTCCCCTGGAAGCTGG No data
1069960066_1069960076 15 Left 1069960066 10:72074216-72074238 CCAAGGCCTTCAGGCTTCTGAAG 0: 1
1: 1
2: 7
3: 132
4: 914
Right 1069960076 10:72074254-72074276 GGCAAGCGTCAGAGCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069960066 Original CRISPR CTTCAGAAGCCTGAAGGCCT TGG (reversed) Intronic
900117596 1:1035138-1035160 CTTCAGCAGCCTGGATCCCTGGG + Intronic
900187084 1:1337632-1337654 CTCCAGGAGCCTGGCGGCCTGGG - Intronic
900196173 1:1376688-1376710 CCTCAGAAGCCTGAAGGCCAAGG - Intergenic
900565460 1:3329752-3329774 CTCCAGAAGCCGCACGGCCTGGG - Intronic
900730791 1:4258280-4258302 CATCACAGGCCTGGAGGCCTAGG + Intergenic
901246056 1:7732235-7732257 CTTCAGCAGCCCGAAGTTCTCGG - Intronic
901269475 1:7940819-7940841 CTGCAGAAGCCTGAAGACCAAGG - Exonic
901285521 1:8075585-8075607 CTTCAGAAGAATGCATGCCTCGG - Intergenic
901333730 1:8430697-8430719 GCACAGAAGCCTGAAGGCCTTGG - Intronic
901767434 1:11512097-11512119 CATCAGAGGCCTGAAGGCCCAGG - Intronic
901925432 1:12563276-12563298 CATCATAGGCCTGGAGGCCTAGG + Intergenic
902306357 1:15542632-15542654 CTTCAGACGCCAGAAGTCCCAGG - Intronic
903722682 1:25417796-25417818 CATCAGAAGGTTGAAGCCCTCGG + Intronic
904057439 1:27680653-27680675 CATCACAGGCCTGGAGGCCTAGG - Intergenic
904629094 1:31828201-31828223 ATTAAGAAGCCTGATGGGCTGGG - Intergenic
904958987 1:34316138-34316160 CATCACAGGCCTGGAGGCCTAGG + Intergenic
905631426 1:39521212-39521234 CATCTGAAGCCTGGAGTCCTTGG - Intronic
905666328 1:39764959-39764981 CATCTGAAGCCTGGAGTCCTTGG + Intronic
906373724 1:45276741-45276763 CTTCAGAGGCCAGAAGGCAGTGG + Intronic
906480789 1:46197855-46197877 CTTCAGATTCCTGAAGTCATGGG - Exonic
907315935 1:53572633-53572655 CTGCAGCAGCCTCCAGGCCTTGG + Intronic
907555855 1:55343870-55343892 CATCACAAGCCTGCAGGCCCAGG + Intergenic
908601526 1:65744888-65744910 CATCAAAGGCCTGGAGGCCTAGG + Intergenic
908699263 1:66880850-66880872 CATCACAAGCCTGGAGGCCTAGG + Intronic
908746884 1:67384458-67384480 CATCACAGGCCTGGAGGCCTAGG - Intronic
908871750 1:68620767-68620789 CATCACAGGCCTGGAGGCCTAGG - Intergenic
908932327 1:69331811-69331833 CATCACAAGCCTGGAGGCCTAGG - Intergenic
908933010 1:69340194-69340216 CATCACAAGCCTGGAGGCCTAGG + Intergenic
908963560 1:69730154-69730176 CATCACAGGCCTGAAGGCCTAGG - Intronic
909063401 1:70904928-70904950 CATCACAGGCCTGGAGGCCTAGG + Intronic
909298715 1:73983744-73983766 CATCACAGGCCTGAAGGCATAGG - Intergenic
909757091 1:79240066-79240088 CATCACAAGCCTGGAGGCCTAGG - Intergenic
909774318 1:79464836-79464858 CATCACAGGCCTGGAGGCCTTGG - Intergenic
910563591 1:88618794-88618816 CATCACAGGCCTGGAGGCCTGGG - Intergenic
910895427 1:92064442-92064464 CATAAGAAGCCTTAAGGGCTGGG + Intergenic
911007659 1:93243450-93243472 CATCACAGGCCTGGAGGCCTAGG - Intronic
911474871 1:98362142-98362164 CATCAGAGACCTGAAGGCCTAGG - Intergenic
911530416 1:99037002-99037024 CATCACAAGCCTGGAGGCCTAGG - Intergenic
911708366 1:101040849-101040871 CATCACAGGCCTGGAGGCCTAGG - Intergenic
911741124 1:101387502-101387524 CATCACAGGCCTGGAGGCCTAGG - Intergenic
911753413 1:101524911-101524933 CTCCAGAAGCTTGAAGGACAAGG - Intergenic
911848476 1:102784137-102784159 CATCACAGGCCTGGAGGCCTAGG - Intergenic
911985521 1:104617029-104617051 CATCACAAGCCCGGAGGCCTAGG - Intergenic
912080592 1:105931816-105931838 CATCACAAGCGTGTAGGCCTAGG + Intergenic
912182658 1:107237559-107237581 CATCACAGGTCTGAAGGCCTGGG + Intronic
912907129 1:113718836-113718858 CTTCACAGGCCTGGAGGCCTAGG - Intronic
913175706 1:116271298-116271320 CCTTAGAAGACTGAAGCCCTAGG - Intergenic
913289496 1:117259022-117259044 CATCACAGGCCTGGAGGCCTAGG - Intergenic
914258223 1:145977580-145977602 CTTCATCAGCCTGAGGGCCGAGG + Intronic
915316856 1:155033570-155033592 CTCCAGAAGCCCGTAGGCCGTGG + Exonic
915961804 1:160273225-160273247 CTCCAGAATCCTGGAGGTCTGGG + Intergenic
915997236 1:160575771-160575793 CTCCAGTAGCCTGAATGGCTTGG + Intronic
916097643 1:161365361-161365383 CTTCTGAGGCCTGAAGGGATGGG - Exonic
916736004 1:167607696-167607718 CATCAGAGGCCTGGAGGCCTAGG + Intergenic
916829205 1:168474213-168474235 CATCACAGGCCTGGAGGCCTAGG + Intergenic
916948922 1:169759049-169759071 CATCACAGGCCTGGAGGCCTAGG - Intronic
916959182 1:169872132-169872154 CATCACAGGCCTGCAGGCCTAGG + Intronic
917002530 1:170375287-170375309 CTTCAGAGACCCAAAGGCCTAGG - Intergenic
917082600 1:171272022-171272044 CATCACAGGCCTGGAGGCCTAGG + Intronic
917763600 1:178192840-178192862 GTACAGAAGTCTGAAGTCCTAGG + Intronic
917892398 1:179452866-179452888 CATCATAAGCCTGGAGGCCTAGG + Intronic
918718187 1:187818355-187818377 CATCACAGGCCTGGAGGCCTAGG - Intergenic
918727767 1:187947697-187947719 CTGGAAAAGCCTGAATGCCTAGG + Intergenic
918784514 1:188748596-188748618 CATCACAAGCCTAGAGGCCTAGG + Intergenic
918935153 1:190912303-190912325 CATCACAAGCCTCGAGGCCTAGG - Intergenic
919175115 1:194010232-194010254 CATCACAGGCCTGGAGGCCTAGG + Intergenic
919233532 1:194807359-194807381 CATCAGAGGCCTGGAGGCCCAGG + Intergenic
920920480 1:210293647-210293669 CTGCAGAAACCTGAAGGACTTGG - Intergenic
921079104 1:211724758-211724780 GCTCAGAGGCCTGCAGGCCTGGG + Intergenic
921390949 1:214612971-214612993 CTTCAGCTGCCTGAAGGACAGGG - Intronic
921424313 1:214984686-214984708 CATCACAGGCCTGGAGGCCTAGG + Intergenic
921531214 1:216285187-216285209 CATCACAGGCCTGGAGGCCTAGG + Intronic
921621473 1:217330381-217330403 CATCACAGGCCTGGAGGCCTAGG - Intergenic
922393986 1:225177523-225177545 CATCACAGGCCTGGAGGCCTAGG + Intronic
922574988 1:226655405-226655427 CCACAGAGGCCTGCAGGCCTGGG - Intronic
922666096 1:227470852-227470874 CATCACAGGCCTGGAGGCCTAGG + Intergenic
922667825 1:227487826-227487848 CATCACAGGCCTAAAGGCCTGGG - Intergenic
922709184 1:227814204-227814226 CATCACAGGCCTGGAGGCCTAGG - Intergenic
923179206 1:231499603-231499625 CATCACAGGCCTGGAGGCCTAGG - Intergenic
923339209 1:232993702-232993724 CATCACAGGCCTGGAGGCCTAGG + Intronic
923372802 1:233328958-233328980 CTTCCGAGCCCTGAAGGCCTGGG - Intronic
924050773 1:240078025-240078047 CATCACAGGCCTGGAGGCCTTGG + Intronic
924152468 1:241142663-241142685 CATCACAGGCCTGGAGGCCTAGG - Intronic
924707651 1:246512271-246512293 GCTCAGAAGCCTCAAGCCCTGGG - Intergenic
924759276 1:246968938-246968960 CATCACAGGCCTGGAGGCCTAGG - Intronic
1062799148 10:366987-367009 CTTCTGAAGCCTGAGGCTCTTGG - Intronic
1062859274 10:797386-797408 CATCACAAGCCAGGAGGCCTAGG - Intergenic
1063119240 10:3093034-3093056 CCACAGAAGCCTGAACTCCTGGG + Intronic
1065700914 10:28424655-28424677 CTTCAGAGGCCAGAAAGACTTGG - Intergenic
1065840851 10:29699790-29699812 CTTCAGGTGCCCGGAGGCCTGGG - Intronic
1066040807 10:31546509-31546531 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1066083448 10:31954975-31954997 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1066213175 10:33259968-33259990 CTTCAGTCTCCTGAAGGGCTGGG + Intronic
1067196152 10:44120462-44120484 CTTCAGATGACTGCAGCCCTGGG + Intergenic
1067206061 10:44215104-44215126 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1067679785 10:48425232-48425254 CTCCAGGACCCTGAAGGCCAAGG - Intronic
1067747009 10:48943566-48943588 CTTCAGCAGCCTTTAGGCCCAGG - Intronic
1068857015 10:61808134-61808156 CTTCAGAAGCCAGAATAGCTTGG + Intergenic
1069754403 10:70764333-70764355 CTTCAGGAGACTGAAGGCTTGGG + Intergenic
1069754589 10:70765909-70765931 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1069805158 10:71117772-71117794 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1069960066 10:72074216-72074238 CTTCAGAAGCCTGAAGGCCTTGG - Intronic
1070395303 10:76007073-76007095 CTACAGAAGACTGCAGGCCCAGG - Intronic
1070538064 10:77394150-77394172 CATCAGAGCCCTGAGGGCCTGGG + Intronic
1071159260 10:82727304-82727326 CATCACAGGCCTGGAGGCCTAGG + Intronic
1071506935 10:86238242-86238264 CATCACAGGCCTGGAGGCCTAGG + Intronic
1071990176 10:91093619-91093641 CATCACAGGCCTGAAGGCCTAGG - Intergenic
1072206191 10:93207207-93207229 CTTCAGGAACCTGGAGGCCTTGG - Intergenic
1072553718 10:96498313-96498335 CGTGAGAACCCTGAAGGCCTGGG - Intronic
1072738979 10:97898283-97898305 GTTCAGAGGGCTGAAGGCCTAGG + Intronic
1073964860 10:108977736-108977758 CATCACAGGCCTGCAGGCCTAGG + Intergenic
1073979834 10:109142308-109142330 CATCACAAGCCTGAAGACCTAGG + Intergenic
1075530594 10:123225645-123225667 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1076125954 10:127974097-127974119 CTGCAGAAGTCTGCAAGCCTGGG - Intronic
1076481322 10:130786857-130786879 CTGCTGAAACCTGAAAGCCTGGG - Intergenic
1077193434 11:1266009-1266031 CATCAGAAACCTGGAGGCCCAGG - Intergenic
1077525836 11:3064049-3064071 CTTCGCAGGCCTGGAGGCCTAGG - Intergenic
1077575684 11:3381436-3381458 CTCCAGAAACTTGCAGGCCTTGG - Intergenic
1078516007 11:12023179-12023201 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1078687384 11:13546263-13546285 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1078865524 11:15293785-15293807 CTTCAGAAAACTTAAGCCCTAGG - Intergenic
1079537021 11:21526856-21526878 CATCACAGGCCTGGAGGCCTAGG - Intronic
1079949483 11:26784135-26784157 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1080151420 11:29056649-29056671 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1080341775 11:31273089-31273111 CATCACAAGCCTGGAGGCCTAGG - Intronic
1080746009 11:35109380-35109402 CATCACAGGCCTGGAGGCCTGGG + Intergenic
1080853258 11:36089860-36089882 CTTCAGCAACCTGAAGTGCTGGG + Intronic
1080907426 11:36560715-36560737 CTGCAGATGCCTGAAATCCTAGG - Intronic
1080913021 11:36624527-36624549 CTCCAGCAGCCTGAATCCCTGGG + Intronic
1080978993 11:37377532-37377554 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1080982426 11:37424208-37424230 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1081101451 11:39007229-39007251 CATCACAGGCCTGGAGGCCTGGG - Intergenic
1081120216 11:39256652-39256674 CATCATAGGCCTGAAGGCCTAGG - Intergenic
1081376745 11:42368239-42368261 CATCAAAGGCCAGAAGGCCTAGG + Intergenic
1082903639 11:58283413-58283435 CTTCAGGCACCTGAGGGCCTGGG - Intergenic
1083019038 11:59487478-59487500 CTTCAGCATCCCGAAGGGCTGGG - Intergenic
1083136153 11:60678435-60678457 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1083458162 11:62792641-62792663 CTTGAGATGAGTGAAGGCCTGGG + Exonic
1084838676 11:71827236-71827258 CCTCAAAGGCCTGGAGGCCTAGG + Intergenic
1084945990 11:72638823-72638845 CTTGAGAAGGCTGGAGGCCCAGG + Intronic
1085418351 11:76334946-76334968 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1085600902 11:77855161-77855183 CATCACAGGCCTGGAGGCCTAGG - Intronic
1085733605 11:79019931-79019953 ACTCAGGTGCCTGAAGGCCTTGG - Intronic
1085976395 11:81660405-81660427 CATCACAAGCCTGAAGCCCTAGG - Intergenic
1086509739 11:87543485-87543507 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1086559559 11:88152181-88152203 CTTTAAAAGCCTAAAGGCCTTGG - Intronic
1086764285 11:90675645-90675667 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1086769508 11:90744788-90744810 CATCACAAGCATGGAGGCCTAGG + Intergenic
1087731067 11:101779336-101779358 CATCACAGGCCTGGAGGCCTAGG + Intronic
1087793596 11:102432722-102432744 CATCACAGGCCTGGAGGCCTAGG + Intronic
1088048339 11:105480375-105480397 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1088388854 11:109290982-109291004 CATCACAAGCCTGGAAGCCTAGG - Intergenic
1088426996 11:109714986-109715008 CATCAGAGGCCTGGAGGCCTAGG - Intergenic
1088559556 11:111098939-111098961 CTTTGGAAGCCTGTAGACCTGGG - Intergenic
1088989406 11:114938929-114938951 CATCACAGGCCTGAAGGCCTAGG + Intergenic
1089405114 11:118191494-118191516 CATCACAGGCCAGAAGGCCTAGG + Intergenic
1089508123 11:118978696-118978718 CCAGAGAAGCCTTAAGGCCTAGG + Intronic
1089712161 11:120323359-120323381 CTTCAGGAGCCTAAAGGCTGAGG - Intergenic
1090021118 11:123129827-123129849 TGTCAGAAGTCAGAAGGCCTGGG - Intronic
1090179626 11:124685136-124685158 CATCACAAGCCTGGAGGCATAGG + Intronic
1090756388 11:129795298-129795320 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1091082120 11:132681043-132681065 CTTCCTAAGCCTGAAGGACAAGG + Intronic
1091124038 11:133080840-133080862 CTTCAGCATGCAGAAGGCCTAGG - Intronic
1091244577 11:134081353-134081375 CATCACAGGCCTGGAGGCCTAGG + Intronic
1091634089 12:2184246-2184268 CTTCTGAAGCCACGAGGCCTCGG + Intronic
1091670935 12:2451764-2451786 CTTCACCAGCCTCATGGCCTAGG - Intronic
1091690667 12:2595161-2595183 GAGCAGAAGTCTGAAGGCCTGGG + Intronic
1091777925 12:3196805-3196827 CCTCAGAAGTCTGAGGGCCTTGG - Intronic
1091869149 12:3873062-3873084 CTACAGAAGCCAAAAGGCCCGGG + Intronic
1092041555 12:5389545-5389567 CCTAAGAAGCCTGAAGGGATGGG - Intergenic
1092400003 12:8166853-8166875 CCTCAAAGGCCTGGAGGCCTAGG - Intronic
1092618227 12:10234766-10234788 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1092883714 12:12907875-12907897 CTTCAGACTCCTGAAGTGCTGGG + Intronic
1093141889 12:15518374-15518396 CATCACAGGCCTGGAGGCCTGGG - Intronic
1093730751 12:22563080-22563102 GTTCAAAAGCCTGAAAGCCAGGG - Intergenic
1094037016 12:26082255-26082277 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1094282512 12:28755230-28755252 CATCACAGGCCTGAAGGCCTAGG - Intergenic
1094706028 12:32915322-32915344 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1094780862 12:33790149-33790171 CATCATGAGCCTGTAGGCCTAGG - Intergenic
1094785816 12:33846996-33847018 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1095226762 12:39686560-39686582 TATCACATGCCTGAAGGCCTAGG - Intronic
1095300874 12:40582139-40582161 CATCAGAGGCCTGGAGGCTTAGG - Intergenic
1096789407 12:54035607-54035629 GTGCAGAGGCGTGAAGGCCTTGG - Intronic
1096875539 12:54627461-54627483 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1096935396 12:55268627-55268649 CATCAAAGGCCTGGAGGCCTAGG + Intergenic
1097320843 12:58224392-58224414 CTACAGAAGCCTGGAGGGGTGGG - Intergenic
1097401685 12:59135036-59135058 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1097404873 12:59177140-59177162 CATCAAAGGCCTGGAGGCCTAGG - Intergenic
1097410981 12:59252895-59252917 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1097445592 12:59667797-59667819 CATCACAGGCCTGGAGGCCTAGG + Intronic
1097571301 12:61335376-61335398 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1097575627 12:61389256-61389278 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1098163932 12:67673724-67673746 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1098203740 12:68084089-68084111 CATCATAAGCCAGGAGGCCTAGG - Intergenic
1098319791 12:69231941-69231963 CTTCACAGGTCTGAAGGCCTAGG + Intergenic
1098628398 12:72700076-72700098 CATCACAAGCCAGGAGGCCTAGG - Intergenic
1098702284 12:73644833-73644855 CTGCAGAAGACAGAAGGCATAGG - Intergenic
1098836767 12:75433116-75433138 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1099014923 12:77332855-77332877 CTTCAGATGACTGCAGTCCTGGG + Intergenic
1099096364 12:78379279-78379301 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1099214555 12:79838513-79838535 CATCACAGGCCTGGAGGCCTGGG + Intronic
1099407415 12:82281476-82281498 CATCACAGGCCTGGAGGCCTAGG + Intronic
1099525324 12:83711326-83711348 CATCACAGGCCTGCAGGCCTAGG - Intergenic
1099529572 12:83761474-83761496 CTTGAGAAGACTGAAGACCAAGG - Intergenic
1099587103 12:84532914-84532936 CATCACAGGCCTCAAGGCCTAGG + Intergenic
1099635163 12:85203987-85204009 CATCACAGGCCTGAAGGCCTAGG + Intronic
1099675442 12:85755396-85755418 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1099932609 12:89091447-89091469 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1100230369 12:92600534-92600556 CATCACCAGCCTGGAGGCCTAGG - Intergenic
1101194686 12:102370135-102370157 CTTCACAGGCCTGGAAGCCTAGG - Intergenic
1101258011 12:102998428-102998450 CATCACAAACCTGGAGGCCTAGG - Intergenic
1101935573 12:109053487-109053509 GTTCTGAAGCCTGGAGCCCTTGG - Intronic
1102245739 12:111354591-111354613 CTTCAGATGACTGCAGCCCTGGG - Intergenic
1102712467 12:114940140-114940162 CTTCAGATGACTGCAGCCCTGGG - Intergenic
1103223555 12:119267178-119267200 CGTCACAGGCCTGGAGGCCTAGG + Intergenic
1103249025 12:119484114-119484136 ATTCAGAAGCCAGACTGCCTGGG + Intronic
1103264539 12:119617971-119617993 CATCACAGGCCTGGAGGCCTAGG + Intronic
1103384099 12:120518166-120518188 CTCCTGAAGCCTGAAGTGCTGGG - Intronic
1104172143 12:126292204-126292226 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1104210529 12:126684181-126684203 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1104830048 12:131744084-131744106 CATCACAGGCCTGGAGGCCTAGG - Intronic
1104961641 12:132490837-132490859 CTTCAGCACCCTGGAGGCCCTGG + Exonic
1105587735 13:21760419-21760441 CTGCAGGATCCTGAAGGCCAGGG + Intergenic
1105608238 13:21944845-21944867 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1106048140 13:26165041-26165063 CATCATAAGCCTGGAGGCCTAGG + Intronic
1106877278 13:34087967-34087989 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1107039492 13:35933742-35933764 CATCACAAGCCTGGAGGCCTAGG - Intronic
1107114522 13:36732740-36732762 CGTGAGAAAACTGAAGGCCTGGG - Intergenic
1107961894 13:45566414-45566436 CATCACAGGCCTGAAGGCCTAGG + Intronic
1108100083 13:46945112-46945134 CATCATAGGCCTGAAGGCCTAGG - Intergenic
1108609408 13:52069511-52069533 CTATATAAGACTGAAGGCCTGGG - Intronic
1108832503 13:54497976-54497998 CATCACAGGCCTGAAGACCTAGG + Intergenic
1108979533 13:56492650-56492672 CATCAAAGGCCTGGAGGCCTAGG - Intergenic
1109294493 13:60513305-60513327 CATCACAAGCCAGGAGGCCTAGG - Intronic
1109297565 13:60552961-60552983 CATCACAGGCCCGAAGGCCTGGG - Intronic
1109390147 13:61682504-61682526 CATCACAGGCCTGGAGGCCTGGG + Intergenic
1109485288 13:63010330-63010352 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1109655703 13:65387910-65387932 CATCACAGGCCTGGAGGCCTGGG + Intergenic
1109857866 13:68156623-68156645 CATCACAGGCCTGATGGCCTAGG - Intergenic
1109962081 13:69644596-69644618 CATCATAGGCCTGGAGGCCTTGG + Intergenic
1110033814 13:70653957-70653979 CATCACAGGCCTGAAGGCCTAGG + Intergenic
1110083428 13:71346013-71346035 CATCACAGGCCCGAAGGCCTAGG - Intergenic
1110342003 13:74402775-74402797 CTTCACAGGCCTGGAGGCCTAGG - Intergenic
1110970818 13:81758686-81758708 CATCAAAGGCCTGGAGGCCTAGG - Intergenic
1111072523 13:83187589-83187611 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1111385425 13:87521285-87521307 CATCACAAGCCTGGAGGTCTAGG + Intergenic
1111457681 13:88506293-88506315 CATCAGAGGCATGGAGGCCTAGG + Intergenic
1111505506 13:89183973-89183995 CTTCACAAGCCTGGAGGTGTAGG - Intergenic
1112031392 13:95459659-95459681 CATCACAGGCCTGGAGGCCTAGG - Intronic
1112163089 13:96889328-96889350 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1112512201 13:100019996-100020018 CTTCACAGGCCTGGAGGCCTAGG + Intergenic
1112719329 13:102225142-102225164 TTTCAGAGCTCTGAAGGCCTGGG - Intronic
1112789574 13:102988105-102988127 CGTCACAGGCCTGGAGGCCTAGG - Intergenic
1112864182 13:103872853-103872875 CATCACAAGCCTGGACGCCTAGG - Intergenic
1113060996 13:106322782-106322804 CATCATAGGCCTGAAGGCCTAGG + Intergenic
1113167040 13:107453559-107453581 CATCACAGGCCTGGAGGCCTAGG - Intronic
1114228449 14:20759559-20759581 CTTCAGGAGGCTGAAGCACTAGG + Intergenic
1114795723 14:25712736-25712758 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1114921935 14:27343192-27343214 CATCACATGCCTGGAGGCCTAGG + Intergenic
1114942002 14:27624029-27624051 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1115199159 14:30834592-30834614 CATCACAGGCCTGAAGGCCTAGG - Intergenic
1115474320 14:33799562-33799584 CTTCAGAGGACTTAAGACCTGGG - Intronic
1116147899 14:41099423-41099445 CATCACAGGCCTGAAGGCCCAGG + Intergenic
1116263517 14:42660641-42660663 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1116272421 14:42788636-42788658 CTTTAGAGATCTGAAGGCCTAGG - Intergenic
1116293464 14:43073793-43073815 CTTCACAGGCCTGGAGGCCTAGG + Intergenic
1116296703 14:43119910-43119932 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1116387347 14:44348095-44348117 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1116714202 14:48407266-48407288 CATCACAGGCCTGATGGCCTAGG - Intergenic
1116742622 14:48776333-48776355 CATCACAAACCTGGAGGCCTAGG + Intergenic
1116784078 14:49268646-49268668 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1116789692 14:49327345-49327367 CATCAAAGGCCTGGAGGCCTAGG + Intergenic
1116931389 14:50694482-50694504 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1117203644 14:53418337-53418359 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1117234292 14:53754859-53754881 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1117293842 14:54360919-54360941 CTACACAAGCCTGAAGCCTTGGG + Intergenic
1117854230 14:60010475-60010497 CATCACAGGCCTGGAGGCCTAGG - Intronic
1117907467 14:60605500-60605522 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1117908269 14:60612256-60612278 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1117945321 14:61013714-61013736 CTTCACAAGCCAGAAGACATTGG - Intronic
1118069567 14:62231626-62231648 CATCACAGGCTTGAAGGCCTAGG + Intergenic
1119025734 14:71150922-71150944 CATCACAGGCCCGAAGGCCTAGG + Intergenic
1119130858 14:72171930-72171952 CTTCTGGAGCCAGATGGCCTAGG - Intronic
1119564919 14:75620296-75620318 CTGCAGAAGCCTGCCTGCCTGGG + Intronic
1119963069 14:78881901-78881923 CATCACAAACCTGGAGGCCTAGG + Intronic
1120230508 14:81836329-81836351 CATCACAGGCCTGAAGGTCTAGG + Intergenic
1120257680 14:82141055-82141077 CATCACAAGCCTGGAAGCCTAGG + Intergenic
1120326520 14:83036665-83036687 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1120342905 14:83244942-83244964 CATCATAGGCCTGGAGGCCTTGG + Intergenic
1120392771 14:83929606-83929628 CATCACAAGCCTGGAGACCTAGG + Intergenic
1120457740 14:84754310-84754332 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1120582645 14:86272204-86272226 CATCACAGGCCTAAAGGCCTAGG - Intergenic
1120623230 14:86791968-86791990 CATCACAAGCCTGGAGGACTAGG + Intergenic
1120661612 14:87257608-87257630 CATCACAAGCATGCAGGCCTAGG + Intergenic
1120693821 14:87621831-87621853 CATCAGAGTCCTGGAGGCCTGGG - Intergenic
1120799824 14:88675548-88675570 CATCACAGGCCTGGAGGCCTAGG - Intronic
1121128783 14:91427045-91427067 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1121130183 14:91439009-91439031 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1121162985 14:91762333-91762355 CTTCAGAAGCCAGAAGAGATTGG + Intronic
1121237984 14:92406778-92406800 CATCACAAGCCTGGAGGCCTAGG - Intronic
1121667424 14:95683982-95684004 CTTCACAAGCCCCAAGCCCTGGG - Intergenic
1122246382 14:100406084-100406106 CTTCTGAAGCCTCTAAGCCTTGG - Intronic
1122257631 14:100490593-100490615 TTTCAAAAACCTGGAGGCCTAGG - Intronic
1122756445 14:103984326-103984348 CATCACAGGCCTGGAGGCCTAGG + Intronic
1123143677 14:106108000-106108022 GTGGAGCAGCCTGAAGGCCTCGG - Intergenic
1123191768 14:106578770-106578792 GTGGAGCAGCCTGAAGGCCTCGG - Intergenic
1123220487 14:106851139-106851161 GTGGAGCAGCCTGAAGGCCTCGG - Intergenic
1202856086 14_GL000225v1_random:52982-53004 CTCCAGAATGCTGATGGCCTGGG - Intergenic
1202859624 14_GL000225v1_random:73049-73071 CTCCAGAATGCCGAAGGCCTGGG + Intergenic
1123628882 15:22247196-22247218 CATCACAAGCCCGGAGGCCTAGG + Intergenic
1123795561 15:23766937-23766959 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1124141922 15:27084782-27084804 CTGCAGAAGCCAGGAGGCCAGGG + Intronic
1124336335 15:28860084-28860106 CATCTGCAGCCTGGAGGCCTGGG - Intergenic
1124444930 15:29722244-29722266 CATCACAAGCCTGGAGGCCTAGG + Intronic
1124556104 15:30727321-30727343 CATCACAAGCCAGGAGGCCTAGG - Intronic
1124675167 15:31678449-31678471 CATCACAAGCCAGGAGGCCTAGG + Intronic
1125251756 15:37713213-37713235 CATCACAGGCCTGGAGGCCTGGG + Intergenic
1125371996 15:38987730-38987752 CTACAAAAGCATGAAGCCCTTGG - Intergenic
1125472134 15:40014614-40014636 CATCACAGGCCTGGAGGCCTAGG - Intronic
1126203801 15:46019701-46019723 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1126781128 15:52139889-52139911 CTTCAGATGCCTGATGGTCGTGG + Intronic
1127186433 15:56485587-56485609 CATCACAGGCCTGAAGGCCTAGG + Intergenic
1128185897 15:65643257-65643279 ATTCTGAAGCCTGATGACCTGGG - Intronic
1129480845 15:75824386-75824408 AATCAGAAGCCAGAGGGCCTAGG - Intergenic
1129504174 15:76067292-76067314 CTTCTTACTCCTGAAGGCCTCGG + Intronic
1129620136 15:77136888-77136910 CATCAGAGGCCCGAAGGCCTAGG + Intronic
1129628880 15:77235740-77235762 CATCACAGGCCTGGAGGCCTAGG + Intronic
1131659478 15:94498704-94498726 CATCACAGGCCTGAAGGCCTAGG + Intergenic
1131949441 15:97665318-97665340 CTCCAGCTGGCTGAAGGCCTGGG - Intergenic
1133423744 16:5669328-5669350 CTGCAAAAGCCTCAAGGCTTGGG + Intergenic
1134297805 16:12962296-12962318 TGACAGCAGCCTGAAGGCCTGGG - Intronic
1134584157 16:15396351-15396373 CTTCAGAGGCCTGAAGGGCCAGG + Intronic
1134855189 16:17512706-17512728 GTTCAGAAGCCTGAGAGCTTTGG + Intergenic
1135627361 16:24007777-24007799 TTTCTGGAGCCTGCAGGCCTGGG + Intronic
1135903620 16:26490019-26490041 CTGCCGAAGCCTGGAGGCATGGG + Intergenic
1136192133 16:28622965-28622987 CTTCAGAGGCCTGAAGGGCCAGG - Intronic
1137760433 16:50935842-50935864 CTTCAGAAGCCTGAATTCCTGGG + Intergenic
1139041279 16:63001935-63001957 CATCACAGGTCTGAAGGCCTAGG + Intergenic
1140656604 16:77147282-77147304 CTTGGGAAGCCTGAAGCTCTAGG - Intergenic
1141037860 16:80643827-80643849 CATCACAGGCCTGGAGGCCTAGG - Intronic
1141092745 16:81141353-81141375 CTGCAGCTGCCTGAGGGCCTGGG + Intergenic
1141272816 16:82556324-82556346 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1141666818 16:85470003-85470025 ATTGAGATGCCTGAGGGCCTGGG - Intergenic
1142210971 16:88808308-88808330 CTTCAGAAGCTCGCTGGCCTGGG + Exonic
1142281251 16:89148823-89148845 CATCATAGGCCTGGAGGCCTCGG - Intronic
1142401778 16:89862630-89862652 CAACAGAAGCCTAAAGCCCTGGG + Intronic
1142491882 17:284817-284839 CTGCAGAGGCCTGACGGCCCCGG + Intronic
1142612524 17:1117033-1117055 CTTCAGAAGGCTTAGGGCTTGGG - Intronic
1142997729 17:3770831-3770853 TCTCAGAAGCCTAAAGGCCAGGG - Intronic
1143210892 17:5186455-5186477 CATCACAGGCCTGGAGGCCTAGG - Intronic
1143935760 17:10482284-10482306 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1144351605 17:14402504-14402526 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1144671426 17:17134696-17134718 CTCCAGAAGCAGGAAGGCCATGG - Intronic
1145378207 17:22371188-22371210 CATCACAAGCCTGGAGGCCTAGG - Intergenic
1145772196 17:27501495-27501517 CATCACAGGCCTGGAGGCCTAGG + Intronic
1145943966 17:28759369-28759391 CTCCAGCAGCCTCAGGGCCTGGG - Exonic
1146391750 17:32429524-32429546 CATCACAGGCCTGGAGGCCTGGG + Intergenic
1146555838 17:33823246-33823268 CTTCAGGAACCAGAAGGCTTGGG - Intronic
1146666425 17:34707617-34707639 GTTGAGAAGCCTGAATGGCTTGG - Intergenic
1148830547 17:50428021-50428043 CTTCAGAAGCCTCAGGGCTCAGG + Intronic
1149140551 17:53428260-53428282 CATCACAGGCCTAAAGGCCTAGG + Intergenic
1149341087 17:55687192-55687214 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1149758811 17:59210446-59210468 CTGCAGAAGGCTGTAGTCCTGGG - Exonic
1150203074 17:63377151-63377173 CATCACAGGCCTGGAGGCCTAGG - Intronic
1150350214 17:64438405-64438427 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1151045633 17:70917067-70917089 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1151045905 17:70919372-70919394 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1151135792 17:71944884-71944906 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1151146634 17:72047320-72047342 CCGCAGAAGCATCAAGGCCTCGG + Intergenic
1151249761 17:72825116-72825138 CATCATAGGCCTGGAGGCCTAGG + Intronic
1151315829 17:73321929-73321951 CTTCAGTTTCCTGAAGGCTTAGG - Intergenic
1152439154 17:80294859-80294881 CTTCAGCATCCTGCAGACCTGGG + Exonic
1153748721 18:8208130-8208152 TTTCAGACTCCTGCAGGCCTTGG + Intronic
1153978356 18:10288888-10288910 ATTCAGAATCATGGAGGCCTTGG - Intergenic
1154049723 18:10942799-10942821 CATCACAAGCCTGAAGGCCTAGG + Intronic
1154476808 18:14768188-14768210 CTTTAGAACCCAGAAGGACTGGG + Intronic
1154498455 18:14979974-14979996 CTTCTGAAGCATGCAGTCCTGGG + Intergenic
1155988157 18:32252636-32252658 CATCAGAGGCCAGGAGGCCTAGG - Intronic
1156052395 18:32952576-32952598 CGTCACAGGCCTGGAGGCCTAGG - Intronic
1156081377 18:33340542-33340564 CATCACAAGCCTGGAGGCCCAGG + Intronic
1156183503 18:34634247-34634269 TTTTACAAGCTTGAAGGCCTTGG - Intronic
1156207939 18:34906294-34906316 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1156615877 18:38783581-38783603 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1156914409 18:42448171-42448193 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1157327283 18:46678362-46678384 GATCAGGAGCCTGGAGGCCTGGG + Intronic
1157408779 18:47446482-47446504 CATCACAGGCCTGAAGGCCCAGG + Intergenic
1157722557 18:49936686-49936708 CTTCCTAAACCTGAGGGCCTGGG + Intronic
1157872156 18:51240285-51240307 CTTCAGCCTCCTGAAGTCCTGGG - Intergenic
1158668399 18:59453263-59453285 TTTCATAAGCCAGAAGGGCTTGG - Intronic
1159138192 18:64361502-64361524 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1159555868 18:69943906-69943928 CTTCAGAAGGATGAAGGAGTTGG - Intronic
1159784101 18:72693460-72693482 CTTCACAATCGTTAAGGCCTTGG + Intergenic
1160627229 18:80219049-80219071 CATCACAGGCCTGGAGGCCTAGG - Intronic
1161641162 19:5424152-5424174 GTTCAGAAGCCTCAAGGGGTTGG - Intergenic
1162002697 19:7757528-7757550 CATCAAAGGCCTGGAGGCCTAGG + Intergenic
1164447359 19:28329584-28329606 CATCACAGGCCTGAAGGCCTAGG + Intergenic
1167101198 19:47405265-47405287 CCACAGAAGACTCAAGGCCTGGG + Intronic
1167250466 19:48396249-48396271 CTTCAGAGTCCTGGAGGACTGGG + Intronic
1168106663 19:54169536-54169558 CTTGCGAAGCCTGCAGCCCTGGG - Exonic
1168510688 19:56971331-56971353 CTTCAGCATCCTGAACGCCATGG + Intergenic
1168655417 19:58123843-58123865 CATCACAAGCCTGGAGGCCTAGG - Intergenic
1168676446 19:58281352-58281374 CTTCTGGAGCCTGAAGGGGTGGG - Intronic
925173415 2:1766628-1766650 GTTCAGAAGCCTGCAGTCCAAGG - Intergenic
925527058 2:4814335-4814357 CATCACAGGCCTGGAGGCCTAGG - Intergenic
925612410 2:5712787-5712809 CTGCAGAAGCCAGACTGCCTAGG - Intergenic
925669129 2:6292883-6292905 CATCACAGGCCTGGAGGCCTAGG + Intergenic
926084125 2:10010342-10010364 TTTCTGAGGCCTGCAGGCCTTGG - Intergenic
926461060 2:13130382-13130404 CATTACAGGCCTGAAGGCCTAGG + Intergenic
926734658 2:16063662-16063684 CATCACAAGCCTGGAGGCCTAGG - Intergenic
926768974 2:16351292-16351314 CATCACAGGCCTGGAGGCCTAGG + Intergenic
926816746 2:16805062-16805084 CATCATAAGCCTGGAGGCCTAGG - Intergenic
927007555 2:18866274-18866296 CATCACAGGCCTGAAGGCCTAGG + Intergenic
927338719 2:21954916-21954938 CTTCAGTAGCCTGGAGACATGGG - Intergenic
927341936 2:21992576-21992598 CATCACAGGCCTGGAGGCCTAGG - Intergenic
927389771 2:22582266-22582288 CATCACAGGCCTGGAGGCCTAGG + Intergenic
927409314 2:22806399-22806421 CATCACAGGCCTGAAGGCCTAGG - Intergenic
927638802 2:24834196-24834218 CTCCAGAAGGCTGGAGACCTTGG - Intronic
928725822 2:34172198-34172220 CATCACTAGCCTGGAGGCCTAGG - Intergenic
929081559 2:38127427-38127449 CATCACAGGCCTGGAGGCCTAGG + Intergenic
930076111 2:47407056-47407078 CATCACAAGCCTAGAGGCCTAGG + Intronic
930404815 2:50941950-50941972 CATCAGAGGCCTTGAGGCCTGGG + Intronic
930444270 2:51450906-51450928 CATCACAGGCCTGGAGGCCTAGG + Intergenic
930480561 2:51943641-51943663 ATTCACAGGCCTGGAGGCCTAGG + Intergenic
930523464 2:52497411-52497433 CATCACAGGCCTGGAGGCCTAGG + Intergenic
930628598 2:53727061-53727083 GATCAGAAGTCAGAAGGCCTGGG + Intronic
930960168 2:57251703-57251725 CATCACAGGCCTGGAGGCCTGGG - Intergenic
930961510 2:57267335-57267357 CATCAGATGCCTGAAAACCTAGG - Intergenic
931297080 2:60937821-60937843 CTTCATAAGGATGAAGGCTTTGG - Intergenic
931529612 2:63199370-63199392 TATCACAAGCCTGGAGGCCTAGG + Intronic
931588083 2:63850707-63850729 CTTGAGAAGCCTTAGGGACTGGG + Intronic
931790408 2:65659250-65659272 CTTGAGAGGACTGATGGCCTGGG + Intergenic
932102973 2:68917765-68917787 CTTCAGAGGACTGCAGCCCTGGG - Intergenic
932648556 2:73530988-73531010 CATCACAGGCCTGGAGGCCTAGG - Intronic
932956441 2:76356976-76356998 CATCACAGGCCTGGAGGCCTAGG + Intergenic
933047553 2:77558034-77558056 CATCACAGGCCTGGAGGCCTAGG + Intronic
933464947 2:82640189-82640211 CATCACAGGCCTGGAGGCCTAGG + Intergenic
933578142 2:84093042-84093064 CATCACAGGCCTGGAGGCCTAGG - Intergenic
933690614 2:85176734-85176756 CTTCAGCCTCCTGAAGTCCTGGG - Intronic
933996800 2:87676138-87676160 GTGCAGAAGCCTGAGGGACTGGG + Intergenic
935511688 2:103983943-103983965 GTTCTGAAGTCTGAAGGCCTGGG - Intergenic
936257497 2:110929651-110929673 CATCACAAGCCAGGAGGCCTAGG + Intronic
936297051 2:111274772-111274794 GTGCAGAAGCCTGAGGGACTGGG - Intergenic
936897551 2:117445626-117445648 CATCACAAGCCTGGGGGCCTAGG + Intergenic
936915683 2:117637285-117637307 CATCACAGGCCTGGAGGCCTAGG + Intergenic
937005115 2:118504579-118504601 CTTCTGAAGTCTGAATGCCTGGG + Intergenic
937008887 2:118543924-118543946 CATCACAGGCCTGGAGGCCTAGG + Intergenic
937680062 2:124634006-124634028 CATCACAAGCCTGGAGGCCTGGG - Intronic
938698121 2:133853058-133853080 CATCACAGGCCTGGAGGCCTAGG + Intergenic
939052916 2:137329890-137329912 CATCACAGGCCTGAAGGCCTAGG + Intronic
939587747 2:144025836-144025858 CTTCAGGAGCCTGAAGGAGAGGG + Intronic
939717199 2:145599259-145599281 AACCAGAAGCCTGGAGGCCTTGG + Intergenic
939852885 2:147321230-147321252 CATCACAGGCCTGAAGGCCTAGG + Intergenic
939967192 2:148622028-148622050 GCTCAGAAGTCTGAATGCCTGGG + Intergenic
940360017 2:152786987-152787009 CTTCACAGGTCTGGAGGCCTAGG - Intergenic
940386984 2:153085396-153085418 CATCACACGCCTGGAGGCCTAGG + Intergenic
940484055 2:154275313-154275335 CATCACAGGCCTGGAGGCCTAGG + Intronic
940533149 2:154905122-154905144 CATCACAGGCCTGGAGGCCTAGG - Intergenic
940543026 2:155046063-155046085 CATCACAGGCCTGGAGGCCTAGG - Intergenic
940691692 2:156926644-156926666 CATCACAGGCCTGGAGGCCTAGG - Intergenic
941123692 2:161561431-161561453 CATCAAAGGCCTGGAGGCCTAGG + Intronic
941165533 2:162079161-162079183 CATCACAAGCCAGGAGGCCTAGG - Intergenic
941346200 2:164372349-164372371 CATCACAAGCCTGGAGGCCTAGG + Intergenic
941490581 2:166138340-166138362 CATCACAAGCCTGGAGGCCTAGG + Intergenic
941525220 2:166598258-166598280 CATCACAGGCCTGGAGGCCTAGG - Intergenic
942169353 2:173274761-173274783 CTTCAGAACCCTGCAGGCTTTGG - Intergenic
942283343 2:174389701-174389723 CATCATAGGCCTGGAGGCCTAGG + Intronic
942724797 2:178994515-178994537 CATCACAGGCCTGGAGGCCTAGG - Intronic
942733404 2:179083009-179083031 CATCACAAGTCTGAAGGCTTAGG - Intergenic
943017248 2:182528661-182528683 CATCACAAGCCTGGAGGTCTAGG + Intergenic
943205347 2:184886845-184886867 CATCACAGGCCTGGAGGCCTAGG - Intronic
943543322 2:189244077-189244099 CATCACAGGCCTGGAGGCCTAGG - Intergenic
943620270 2:190140695-190140717 CATCACAGGCCTGGAGGCCTAGG - Intronic
944250162 2:197573717-197573739 CATCACAAGCCTGGAGGCCTAGG + Intronic
944920980 2:204412944-204412966 CATCACAGGCCTGGAGGCCTAGG + Intergenic
945073595 2:206015326-206015348 CATCATAGGCCTGGAGGCCTAGG + Intronic
945166684 2:206954067-206954089 CATCACAGGCCTGGAGGCCTAGG - Intronic
945414693 2:209556343-209556365 CTTCAAAAGAAAGAAGGCCTGGG - Intronic
945534022 2:210989590-210989612 CATCACAGGCCTGGAGGCCTAGG + Intergenic
945593973 2:211768764-211768786 CATCACAAGCCAAAAGGCCTAGG - Intronic
945618648 2:212106689-212106711 CATCACAGGCCTGGAGGCCTAGG + Intronic
945900633 2:215533900-215533922 CATCACAAGCCTGGAGGCCTAGG + Intergenic
946732290 2:222721035-222721057 CATCACAGGCCTGGAGGCCTAGG - Intergenic
946775729 2:223138638-223138660 CTCCAGAAGGCAGTAGGCCTAGG - Intronic
947328044 2:228999494-228999516 CATCACAGGCCTGCAGGCCTAGG + Intronic
947893476 2:233646257-233646279 CATCACAGGCCTGGAGGCCTAGG - Intronic
947903063 2:233738906-233738928 CATCACAGGCCTGGAGGCCTAGG + Intronic
947904480 2:233750571-233750593 CATCACAGGCCTGGAGGCCTAGG + Intronic
948016787 2:234697517-234697539 CATCACAGGCCTGGAGGCCTAGG - Intergenic
948476592 2:238224790-238224812 CTTCAGATGCCGGCAGGCCCCGG + Intronic
948615679 2:239197238-239197260 CTTCAGAATCCCGAAGGCGAAGG - Intronic
948738280 2:240025281-240025303 CTTCAGGAGCCGCAAGGCCATGG + Exonic
1169022975 20:2343471-2343493 CTTCAGACTCCTGAAGTTCTGGG - Intergenic
1169101959 20:2958153-2958175 GTTCAAGAGACTGAAGGCCTGGG + Intronic
1169308348 20:4514324-4514346 CTACAGAAACCTGTAGACCTAGG - Intergenic
1169662069 20:7990514-7990536 CCTCAGATGCATGGAGGCCTTGG - Intronic
1170700976 20:18703202-18703224 CTTCAGAATTCTGAAGGCCATGG + Intronic
1170741775 20:19064947-19064969 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1170750391 20:19139789-19139811 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1171399636 20:24864599-24864621 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1171426189 20:25050236-25050258 GTTCAGAAGCCAGAAGTCCATGG - Intronic
1172245194 20:33441283-33441305 GTTCTGGAGCCTGGAGGCCTAGG - Intronic
1172812033 20:37654972-37654994 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1173010026 20:39173844-39173866 CTTCAGGAGCCTGATGTCCCTGG - Intergenic
1173889760 20:46497271-46497293 CTTCAGAAGCCTGATGCTCCTGG - Intergenic
1174847323 20:53955238-53955260 CTTCAGAGGGCAGAAGTCCTTGG + Intronic
1175003276 20:55653532-55653554 TTTCAGAAAGCTGAAGACCTAGG - Intergenic
1176860489 21:14009169-14009191 CAGCAGCAGCCTGCAGGCCTGGG - Intergenic
1177067907 21:16463860-16463882 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1177169625 21:17640779-17640801 CATCACAAGCCTAGAGGCCTAGG - Intergenic
1177236169 21:18392076-18392098 CATCACAGGCCTGGAGGCCTAGG - Intronic
1177285205 21:19040554-19040576 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1177394715 21:20518263-20518285 CTTCTGAAGCATGGAGACCTTGG - Intergenic
1177762771 21:25420619-25420641 CCTCAGAAGGCTGAATGACTTGG + Intergenic
1177839239 21:26218058-26218080 CATCACAGGCCTGCAGGCCTAGG + Intergenic
1178011374 21:28290414-28290436 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1178046224 21:28697022-28697044 CCTTACAGGCCTGAAGGCCTAGG - Intergenic
1178143923 21:29716903-29716925 CATCATAGGCCTGGAGGCCTAGG + Intronic
1179936643 21:44610289-44610311 CATCAGAGGCCTGGAGGCCTGGG + Intronic
1180153397 21:45964790-45964812 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1180187939 21:46149668-46149690 CTCCAGAAGCCTTGAGGCCCAGG + Intronic
1181036587 22:20172595-20172617 CTTCAGGAGCCGGAAGTTCTAGG + Intergenic
1181621214 22:24092520-24092542 CTTCAGAAGCTTCAAGTCCTGGG - Intronic
1181771591 22:25129529-25129551 ATTCTGGAGCCAGAAGGCCTGGG + Intronic
1181910938 22:26237771-26237793 CTTCACAGGCTTGGAGGCCTAGG - Intronic
1182125631 22:27813849-27813871 CCTCAGAAGCCTGATGACCTCGG + Intergenic
1182395143 22:30030105-30030127 GTTCAGAGGCATGAAGGTCTGGG + Intronic
1183004460 22:34889818-34889840 CATCACAGGCCTGAAGGCCTAGG + Intergenic
1183749759 22:39713163-39713185 CTTCAGAAGCCTGCAGCCTGGGG - Intergenic
1183998965 22:41658288-41658310 CTTCAGGAACCTGGAGGCCTTGG + Exonic
1184530566 22:45052597-45052619 TTTCACAAGCCTGATGGACTGGG - Intergenic
1184746559 22:46459528-46459550 GCTCAGAAGCCAGAATGCCTGGG + Intronic
1184877766 22:47286340-47286362 CTGCAGGAGCCAGAAGTCCTGGG - Intergenic
1185171756 22:49298390-49298412 CTTCAGAGGCCTGAAAGCCGGGG + Intergenic
949464448 3:4329614-4329636 CATCAGAAACCTGGAGGCATAGG - Intronic
949612258 3:5715053-5715075 CTTCTGAAGCCTCTGGGCCTGGG - Intergenic
950672501 3:14535744-14535766 CTTAGGGAGCCAGAAGGCCTGGG - Intronic
951034479 3:17918116-17918138 CTTGAGAAGCCTGCAGTCCGGGG + Intronic
951044445 3:18022615-18022637 CCTCAGAAGCCTGACTTCCTGGG + Intronic
951446190 3:22782840-22782862 CATCACAGGCCTGGAGGCCTAGG - Intergenic
951773529 3:26284084-26284106 CATCAAAGGCCTGGAGGCCTAGG - Intergenic
951811930 3:26710068-26710090 CTTCAATAACCTGAAGGCCAGGG + Exonic
952480267 3:33754011-33754033 CATCACAAGCCTGGAGGTCTAGG - Intergenic
952939747 3:38433300-38433322 CATCACAGGCCTGGAGGCCTAGG - Intergenic
953235536 3:41103248-41103270 CTTCTGAAGCGTGCTGGCCTAGG - Intergenic
953624874 3:44562368-44562390 CATCACAGGCCTGGAGGCCTAGG - Intronic
953898537 3:46823537-46823559 CATCACAGGCCTGGAGGCCTAGG - Intergenic
954437906 3:50505551-50505573 CTTCATGTGCCTGACGGCCTGGG - Intergenic
955749666 3:62175036-62175058 CTTCAGAAGTATGAGAGCCTAGG - Intronic
956169581 3:66422113-66422135 CATCACAGGCCTGGAGGCCTAGG - Intronic
956599988 3:71010294-71010316 CTTCTGAAGCCAGACTGCCTGGG + Intronic
956913334 3:73844296-73844318 CTTCAGCATCTTCAAGGCCTAGG + Intergenic
957267248 3:77983040-77983062 CATCACAAGCTTGTAGGCCTAGG - Intergenic
957495073 3:80982150-80982172 CATCAAAGGCCTGGAGGCCTAGG + Intergenic
957662799 3:83183521-83183543 CATCACATGCCTGGAGGCCTAGG + Intergenic
957787418 3:84900909-84900931 CATCACAGGCCTGAAGGCCCAGG + Intergenic
957843418 3:85699710-85699732 CATCACAGGCCTGGAGGCCTAGG - Intronic
957873072 3:86112499-86112521 CATCACAGGCCTGGAGGCCTAGG + Intergenic
958085029 3:88795724-88795746 CATCACAGGCCTGGAGGCCTGGG - Intergenic
958577673 3:95973805-95973827 CATCACAAGCCTGGAGACCTAGG + Intergenic
958672223 3:97219652-97219674 CATCACAAGTCTGGAGGCCTAGG - Intronic
958893484 3:99805375-99805397 CATCACAGGCCTGGAGGCCTGGG - Intergenic
959229663 3:103632133-103632155 CATCACAGGCCTGGAGGCCTAGG + Intergenic
959390072 3:105762383-105762405 CATCACAGGCCTGGAGGCCTAGG + Intronic
959512827 3:107233559-107233581 CATCACAGGCCAGAAGGCCTGGG + Intergenic
959754771 3:109883990-109884012 CATCACAGGCCTGGAGGCCTAGG - Intergenic
959785725 3:110295105-110295127 CATCACAGGCCTCAAGGCCTAGG - Intergenic
959838652 3:110949421-110949443 CATCACAGGCCTGGAGGCCTAGG - Intergenic
959931978 3:111994988-111995010 CTGCAAAACCCTGAAAGCCTAGG - Intergenic
960058417 3:113293897-113293919 CTTCAGAAGCCTGAGGGGAGGGG - Intronic
960496692 3:118383889-118383911 CATCACAAGCCTGGAGGCCTAGG + Intergenic
960564448 3:119118528-119118550 CATCAGAGGCCTGGAGGCCTAGG - Intronic
960581408 3:119282472-119282494 CATCACAAGCCAGGAGGCCTAGG + Intergenic
961210235 3:125119985-125120007 CCCCAGAGGCCTGACGGCCTGGG + Intronic
961701863 3:128750817-128750839 CATCACAGGCCTGGAGGCCTAGG + Intronic
962057296 3:131886094-131886116 CATCACCAGCCTGAAGGCCTAGG + Intronic
962223314 3:133582744-133582766 GTTGAGAAGCTTGAAGACCTAGG + Intronic
962339536 3:134570110-134570132 CATCACAGGCCTGGAGGCCTAGG - Intronic
962509437 3:136084146-136084168 CATCACAGGCCTGGAGGCCTAGG + Intronic
962906783 3:139810850-139810872 CTGCAGCAGCCTGATGGCCAGGG - Intergenic
963011710 3:140776119-140776141 CATCACAGGCCTGGAGGCCTAGG - Intergenic
963297066 3:143557998-143558020 CATCACAGGCCTGGAGGCCTAGG + Intronic
963363268 3:144303474-144303496 CATCACAGGCCTGGAGGCCTAGG - Intergenic
963391200 3:144665857-144665879 CATCACAGGCCTGGAGGCCTAGG - Intergenic
963421059 3:145061481-145061503 CTTCAGAAGGTGGAAGCCCTAGG - Intergenic
963422131 3:145073574-145073596 CATCACAGGCCTGAAGGCCCAGG - Intergenic
963593039 3:147286752-147286774 CATCACAGGCCTGGAGGCCTAGG - Intergenic
964090903 3:152874337-152874359 CATCACAAGCCTGGAGGTCTAGG - Intergenic
964456997 3:156879663-156879685 CATCACAGGCCTGGAGGCCTAGG + Intronic
964520729 3:157563682-157563704 CATCACAGGCCTGGAGGCCTAGG - Intronic
964737853 3:159934468-159934490 CATCACAGGCCTGGAGGCCTAGG - Intergenic
964989159 3:162785214-162785236 CATCACAGGCCTGGAGGCCTAGG - Intergenic
965083380 3:164064483-164064505 CATCATAGGCCTGGAGGCCTAGG + Intergenic
965146615 3:164913146-164913168 CATCACAGGCCTGGAGGCCTAGG - Intergenic
965809716 3:172579157-172579179 CATCACAGGCCTGGAGGCCTAGG + Intergenic
965854631 3:173073380-173073402 CATCACAGGCCTGAAGGCCTAGG + Intronic
965904932 3:173692671-173692693 CTACAGAACCCTGAAGGCAAAGG + Intronic
966074992 3:175924959-175924981 CATCACAGGCCTGGAGGCCTAGG - Intergenic
966942446 3:184755604-184755626 CTGGAGAAGCGTGAAGGCTTTGG + Intergenic
967188129 3:186962621-186962643 GTTCAGAAGCCTGAAGAATTTGG + Intronic
968392189 4:202982-203004 CATCACAGGCCAGAAGGCCTAGG + Intergenic
968758075 4:2427080-2427102 GTACAGAAGCCTGCAGCCCTCGG - Intronic
968867247 4:3221161-3221183 CTGCAGAAGCCCGAGGGACTGGG - Intronic
968986462 4:3877991-3878013 CTCCAGGAGTCTGAAGACCTCGG - Intergenic
969103582 4:4788492-4788514 CATCAAAAGCCTAGAGGCCTAGG + Intergenic
969338955 4:6528418-6528440 CTTCAGGATCCTGCAGACCTAGG + Intronic
969780099 4:9394721-9394743 CCTCAAAGGCCTGGAGGCCTAGG + Intergenic
970036610 4:11742495-11742517 CTTCTGAAGTCTGTAGCCCTGGG - Intergenic
970060273 4:12025720-12025742 CACCAGAAGCCAGAAGGCATGGG + Intergenic
970217666 4:13776681-13776703 CATCAAAGGCCTGGAGGCCTAGG - Intergenic
970302042 4:14691948-14691970 CATCACAAGCCTGGAGGCCTAGG + Intergenic
970344070 4:15136184-15136206 CATCACAGGCCTGGAGGCCTAGG - Intergenic
970382156 4:15518893-15518915 CATCACAGGCCTGAAGGCCTAGG - Intronic
970554262 4:17215390-17215412 CATCACAGGCCTGGAGGCCTAGG - Intergenic
970659252 4:18265390-18265412 CATCACAAGCCTGAAGGCCTAGG - Intergenic
970665838 4:18335064-18335086 CATCACAGGCCTGGAGGCCTAGG + Intergenic
970715160 4:18913257-18913279 CATCACAGACCTGAAGGCCTAGG + Intergenic
970997396 4:22283007-22283029 CATCACAGGCCTGGAGGCCTAGG + Intergenic
971070003 4:23080373-23080395 CATCACAGGCCTGGAGGCCTAGG - Intergenic
971375680 4:26053991-26054013 CTTCAGCATCCTGAAGGCCGTGG + Intergenic
971601326 4:28595717-28595739 CATCACAAGCCTGGAGGCCTAGG + Intergenic
971744807 4:30566196-30566218 CATCACAAGCCTGGAGGCTTAGG + Intergenic
971939748 4:33199737-33199759 CATCACATGCCTGAAGGCCTAGG + Intergenic
972660168 4:41108739-41108761 CTGCTGAAGGCTGTAGGCCTGGG - Intronic
972930227 4:44063466-44063488 CTTCAAAAGCCCAATGGCCTAGG + Intergenic
972988785 4:44798521-44798543 CATCACAGGCCTGGAGGCCTAGG + Intergenic
973545550 4:51978090-51978112 CATCAGAAGACTGAAGGAGTTGG - Intergenic
973996462 4:56464116-56464138 CTTCTGCAGGCTGAAGGCCCAGG - Intergenic
974012992 4:56624504-56624526 CATCACAGGCCTGGAGGCCTAGG + Intergenic
974178657 4:58358130-58358152 CATCACAGGCCTGAAGGCCTAGG + Intergenic
974219505 4:58948094-58948116 CATCACAAGCCAGGAGGCCTAGG - Intergenic
974319885 4:60333837-60333859 CATCACAAGCCTTCAGGCCTAGG + Intergenic
974395056 4:61323245-61323267 CATCACAGGCCTGAAGGCATAGG - Intronic
974628502 4:64453867-64453889 CATCACAGTCCTGAAGGCCTGGG - Intergenic
974923493 4:68270452-68270474 CATCATAGGCCTGGAGGCCTAGG - Intergenic
975038178 4:69710381-69710403 CATCACAAGTCTGGAGGCCTAGG - Intergenic
975729273 4:77321493-77321515 CATCACAGGCCTGGAGGCCTAGG - Intronic
975853623 4:78599543-78599565 TTTCAGAAACCTGAAAGACTGGG + Intronic
976000821 4:80371279-80371301 CATCACAGGCCTGGAGGCCTAGG - Intronic
976277130 4:83289431-83289453 CATCACAAGCCAGGAGGCCTAGG + Intergenic
976405651 4:84658355-84658377 CATCACAGGCCTGGAGGCCTAGG - Intergenic
976589288 4:86833122-86833144 CTCTTGAAGCCTGAAGACCTAGG + Intronic
976748232 4:88427438-88427460 CTGCAGAAGTCTGCAGGTCTGGG - Intronic
976842319 4:89445791-89445813 CATCAGAGGCCTGGAGGCCTAGG - Intergenic
976988106 4:91327500-91327522 CATCACAGGCCTGGAGGCCTAGG - Intronic
977336655 4:95708172-95708194 CTTCAGAAGCCTAGAGGACTAGG + Intergenic
977415943 4:96733281-96733303 CATCACAGGCCTGGAGGCCTAGG + Intergenic
977435410 4:96989124-96989146 CCTCACAAGCCTAGAGGCCTAGG + Intergenic
977512006 4:97973607-97973629 CATCACAGGCCTGGAGGCCTAGG + Intronic
977545010 4:98367068-98367090 CATCACAGGCCTGGAGGCCTAGG + Intronic
978101121 4:104841621-104841643 CATCATAGGCCTGGAGGCCTAGG - Intergenic
978237778 4:106480624-106480646 CTTCAGAAGCCACAAGGGATTGG - Intergenic
978666055 4:111183187-111183209 CATCACAGGCCTGGAGGCCTAGG - Intergenic
978904011 4:113985265-113985287 CATCACAGGCCTGGAGGCCTAGG + Intergenic
978915731 4:114124272-114124294 CATCACAGGCCTGGAGGCCTAGG - Intergenic
978991204 4:115084509-115084531 CATCACAGGCCTGGAGGCCTAGG + Intronic
979182808 4:117752992-117753014 CATCAGACGCCTGGAGGCCTAGG + Intergenic
979411431 4:120384421-120384443 CATCACAGGCCTGGAGGCCTAGG + Intergenic
979805174 4:124961604-124961626 CATCACAGGCCTGGAGGCCTGGG - Intergenic
979895888 4:126156728-126156750 CATCACAGGCCTGGAGGCCTAGG - Intergenic
979895908 4:126156822-126156844 CATCACAGGCCTGGAGGCCTAGG - Intergenic
980346802 4:131633018-131633040 CATCACAGGCCTGGAGGCCTAGG + Intergenic
980458251 4:133073044-133073066 CATCACAGGCCTGGAGGCCTAGG + Intergenic
980596492 4:134962138-134962160 CATCACAGGCCTGGAGGCCTGGG + Intergenic
980702770 4:136454624-136454646 CATCACAGGCCTGGAGGCCTAGG + Intergenic
980758490 4:137197201-137197223 CTTCAAAATCCTGGAGGACTGGG - Intergenic
981200430 4:141973173-141973195 CATCACAAGATTGAAGGCCTAGG - Intergenic
981308045 4:143267599-143267621 CATCACAAGCCTGGAGGCCTAGG + Intergenic
981356912 4:143799409-143799431 CATCACAGGCCTGGAGGCCTAGG - Intergenic
981378240 4:144040291-144040313 CATCACAGGCCTGGAGGCCTAGG - Intergenic
981611488 4:146597881-146597903 CATCACAAGCCTGCAGGCCTAGG - Intergenic
981862862 4:149378868-149378890 CATCACAAACCTGGAGGCCTGGG + Intergenic
982075968 4:151737643-151737665 CATCACAGGCCTGGAGGCCTAGG + Intronic
982299839 4:153867543-153867565 CATCACAGGCCTGGAGGCCTAGG + Intergenic
982301165 4:153880881-153880903 CATCAAAGGCCTGGAGGCCTAGG + Intergenic
983006353 4:162490204-162490226 CATCACAGGCCTGGAGGCCTAGG + Intergenic
983298067 4:165891185-165891207 CATCACAAGCCAGAAGGCTTGGG - Intronic
983379076 4:166968381-166968403 CATCACAGGCCTGGAGGCCTAGG + Intronic
983475038 4:168203389-168203411 CATTACAGGCCTGAAGGCCTAGG + Intergenic
983825092 4:172249552-172249574 CATCACAAACCTGGAGGCCTAGG + Intronic
983886753 4:172988640-172988662 CATCACAGGCCTGGAGGCCTAGG + Intronic
984553341 4:181185692-181185714 CATCACAAGCCTGGAGGCCTAGG - Intergenic
984865489 4:184277138-184277160 CATCACAAGCCTGGAGGCCTAGG + Intergenic
985220271 4:187696789-187696811 CATCACAGGCCTGGAGGCCTAGG + Intergenic
985301344 4:188493128-188493150 CTTCAGAATCCTTCAGGCGTTGG + Intergenic
985337749 4:188914294-188914316 CATCACAGGCCTGAAGGCCTAGG - Intergenic
985371703 4:189292155-189292177 CATCACAGGCCTGGAGGCCTAGG + Intergenic
985972776 5:3391402-3391424 CCCTTGAAGCCTGAAGGCCTAGG - Intergenic
986105553 5:4656147-4656169 CATCATAGGCCTGGAGGCCTAGG - Intergenic
986163087 5:5249098-5249120 GTCCTGGAGCCTGAAGGCCTAGG + Intronic
986246582 5:6012434-6012456 CATCACAGGCCTGGAGGCCTAGG - Intergenic
987000027 5:13651226-13651248 CATCACAGGCCTGGAGGCCTAGG + Intergenic
987216615 5:15744041-15744063 CTTCACAGGCCTGGAGGCCTAGG - Intronic
987254651 5:16138175-16138197 CATCACAAGCCAGGAGGCCTAGG + Intronic
987433517 5:17865184-17865206 CATCATAGGCCTGGAGGCCTAGG + Intergenic
987455424 5:18138697-18138719 CATCAAAAGACTGGAGGCCTAGG - Intergenic
987457594 5:18165913-18165935 CATCACAGGCCTGGAGGCCTAGG - Intergenic
987509346 5:18815512-18815534 CTTCACAGGCCTGGAGGCATAGG - Intergenic
987542764 5:19276635-19276657 CATCACAGGCCTGGAGGCCTAGG + Intergenic
987597480 5:20020434-20020456 CATCAAAGGCCTGGAGGCCTAGG + Intronic
987602120 5:20084893-20084915 CATCACAAGCCTGGAGGCCTAGG - Intronic
987697860 5:21355233-21355255 CATTATAAGCCTGGAGGCCTAGG - Intergenic
987792085 5:22581193-22581215 CATCACAGGCCTGAAGGCCTAGG + Intronic
987802883 5:22721105-22721127 CATCACAGGCCTGAAGGCCTAGG + Intronic
987830359 5:23087398-23087420 CTTCAGGAGCCTGAATGGTTAGG - Intergenic
987862001 5:23500683-23500705 CATTAGAGGCCTGGAGGCCTAGG - Intergenic
987967380 5:24893758-24893780 CATTACAAGCCTGGAGGCCTGGG - Intergenic
987984854 5:25133827-25133849 CATCACAGGCCTGGAGGCCTAGG + Intergenic
988061416 5:26175422-26175444 CATCACAGGCCTGGAGGCCTAGG + Intergenic
988256187 5:28823122-28823144 CATCACAAGCCTGGAGGCCTAGG + Intergenic
989144435 5:38234905-38234927 CATCACAAGCCTAGAGGCCTAGG + Intergenic
989168994 5:38456856-38456878 CTTCAAAAGCTTGATGGCCTAGG + Intronic
990083359 5:51944635-51944657 CATCACAGGCCTGGAGGCCTAGG + Intergenic
990135987 5:52644916-52644938 CCTCACAGGCCTGGAGGCCTAGG + Intergenic
990213760 5:53508316-53508338 CTTCACAGGCCTGGAGGCCTAGG - Intergenic
990526034 5:56628804-56628826 CATCACAGGCCTGGAGGCCTAGG + Intergenic
990701107 5:58475630-58475652 CATCAGAGGCCCGGAGGCCTAGG - Intergenic
990788951 5:59455217-59455239 CATCACAGGCCTGGAGGCCTAGG + Intronic
991010003 5:61872402-61872424 CATCACAGGCCTGGAGGCCTAGG - Intergenic
991116891 5:62964636-62964658 CATCACAGGCCTGGAGGCCTAGG - Intergenic
991122504 5:63032472-63032494 CATCACAGGCCTGGAGGCCTAGG + Intergenic
991302848 5:65145704-65145726 TTTCACAAGCCTTAAGGGCTGGG + Intergenic
991355794 5:65767503-65767525 CATCACAGGCCTGGAGGCCTAGG - Intronic
991742585 5:69697154-69697176 CATTATAAGCCTGGAGGCCTAGG + Intergenic
991755109 5:69858050-69858072 CATTATAAGCCTGGAGGCCTAGG - Intergenic
991794158 5:70276892-70276914 CATTATAAGCCTGGAGGCCTAGG + Intergenic
991821975 5:70572467-70572489 CATTATAAGCCTGGAGGCCTAGG + Intergenic
991834436 5:70733198-70733220 CATTATAAGCCTGGAGGCCTAGG - Intergenic
991886536 5:71276434-71276456 CATTATAAGCCTGGAGGCCTAGG + Intergenic
992306554 5:75445854-75445876 CTTTAGAAGCCAGAAGGTATGGG - Intronic
992375696 5:76185721-76185743 CATCACAGGCCTGGAGGCCTAGG - Intronic
993146097 5:84095867-84095889 CATCATAGGCCTGAAGGCCTAGG + Intronic
993256064 5:85591499-85591521 CATCAGAGGCCTGGAGGCCCCGG - Intergenic
993285474 5:85990944-85990966 CATCACAGGCCTGGAGGCCTAGG + Intergenic
993442905 5:87978514-87978536 CATCACAGGCCTGGAGGCCTAGG + Intergenic
994078754 5:95682882-95682904 CTTAACAAGCTTGCAGGCCTGGG + Exonic
994285120 5:97955659-97955681 CATCATAGACCTGAAGGCCTAGG + Intergenic
994425162 5:99576345-99576367 CATCACAGGCCTGGAGGCCTAGG + Intergenic
994436176 5:99735888-99735910 CATCACAGGCCTGGAGGCCTAGG - Intergenic
994464367 5:100108634-100108656 TATCACAAGCCTGAAGGCCTAGG + Intergenic
994580311 5:101632958-101632980 CATCACAGGCCTGGAGGCCTAGG - Intergenic
994635070 5:102334979-102335001 CTTTAAAAGCCTGAAGGCAATGG + Intergenic
994749592 5:103721432-103721454 CATCACAGGCCTGGAGGCCTAGG - Intergenic
994823281 5:104680518-104680540 CATCACAAGCCTGGAGGCCTAGG + Intergenic
994878935 5:105461189-105461211 CATCACAAGCCTGGAGGCATAGG - Intergenic
995055367 5:107753584-107753606 CATCACAGGCCTGGAGGCCTAGG + Intergenic
995147727 5:108806014-108806036 CATCATAGGCCTGGAGGCCTAGG + Intronic
995189997 5:109309922-109309944 CATCAGAAGCCAGAAGGCAAGGG + Intergenic
995370176 5:111409478-111409500 CATCACAGGCCTGGAGGCCTTGG - Intronic
995429071 5:112054585-112054607 CATCACAGGCCTGGAGGCCTAGG + Intergenic
995724175 5:115167226-115167248 CATCACAGGCCTGGAGGCCTAGG - Intronic
996030970 5:118703447-118703469 CATCACAGGCCTGGAGGCCTAGG - Intergenic
996524686 5:124466064-124466086 CTTCAAAAGCTAGAATGCCTAGG + Intergenic
997092924 5:130878328-130878350 CCTCACATGCCTGGAGGCCTAGG + Intergenic
997116099 5:131127260-131127282 CATCACAGGCCTGGAGGCCTAGG + Intergenic
997181456 5:131832914-131832936 CATCACAGGCCTGGAGGCCTAGG - Intronic
997182344 5:131843201-131843223 CATCACAGGCCTGGAGGCCTGGG - Intronic
998419108 5:141967630-141967652 CTTTAGAATCCTGTAGGCTTGGG + Intronic
998662899 5:144260438-144260460 CTTCAGAAGGCTGCAGAGCTTGG - Intronic
998813976 5:145993746-145993768 CATCACAGGCCTGGAGGCCTAGG - Intronic
999147999 5:149408346-149408368 CTTCTGAACCATGATGGCCTTGG - Intergenic
999148059 5:149408741-149408763 CTTGAGATGCCTGAAGGACTGGG + Intergenic
999418143 5:151417886-151417908 CATCACAGGCCTGGAGGCCTAGG + Intergenic
999461827 5:151763349-151763371 CTTTAGAAACCTGAAGCCCCAGG - Intronic
999476792 5:151907667-151907689 CTACAAAAGTCTCAAGGCCTGGG + Intronic
999747447 5:154603192-154603214 CTTCAGGAGTCAGAAGGCCCTGG + Intergenic
999771015 5:154775544-154775566 CATCTGCAACCTGAAGGCCTGGG - Intronic
1000496392 5:161989920-161989942 CATCACAAGCCTGGAGGCTTAGG - Intergenic
1000575104 5:162966981-162967003 CTTCATAGTCCTGGAGGCCTAGG - Intergenic
1000777918 5:165442403-165442425 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1000929265 5:167231833-167231855 CTTCACAGGCCTGGAGGCCTAGG + Intergenic
1001086276 5:168702001-168702023 CTTCAGCAGCTGGAAGGCATGGG + Intronic
1001426761 5:171627996-171628018 CTTCAGAATCCAAAAGGCCAGGG - Intergenic
1001836405 5:174836459-174836481 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1002536596 5:179879403-179879425 CTTCAGAGGCCTGGAGTCCGTGG + Intronic
1002617950 5:180467229-180467251 TTCCAGAAGCCAGAAGGCCGGGG + Intergenic
1003316270 6:5014911-5014933 CTCCAGAATCTTGAAGGCCTAGG - Intergenic
1003484463 6:6563565-6563587 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1003817981 6:9863066-9863088 TATCACAAGCCTGGAGGCCTAGG - Intronic
1004203183 6:13569133-13569155 GCTCAGGAGCCAGAAGGCCTGGG + Intergenic
1005180148 6:23095526-23095548 CATCACAAGCCTGGAAGCCTAGG + Intergenic
1005329049 6:24731617-24731639 CATCACAGGCCTGTAGGCCTAGG + Intergenic
1005552991 6:26943171-26943193 CATTATAAGCCTGGAGGCCTAGG + Intergenic
1005982947 6:30851528-30851550 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1006217031 6:32453346-32453368 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1007090826 6:39183906-39183928 TTTCATAATCCTGAAAGCCTGGG - Intergenic
1008220909 6:48852457-48852479 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1008261039 6:49366764-49366786 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1008430366 6:51409837-51409859 CTTCAGACGCCTGATGGCATCGG - Intergenic
1008619517 6:53258197-53258219 CTCCAGGAGCCTGTAGGCCATGG + Intergenic
1008756090 6:54797083-54797105 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1009527429 6:64764515-64764537 CATCACAGGCCTGGAGGCCTAGG - Intronic
1009637077 6:66280368-66280390 CATCAGAGGCCTGGAGGCCTAGG + Intergenic
1009680162 6:66881338-66881360 CATCACAAACCTGGAGGCCTAGG - Intergenic
1009723509 6:67506559-67506581 CATCATAAGCCAGGAGGCCTAGG - Intergenic
1010104828 6:72155133-72155155 CATCACAGGCCTGGAGGCCTAGG - Intronic
1010611828 6:77962867-77962889 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1011011230 6:82705810-82705832 CATCAGAGGCCCAAAGGCCTAGG - Intergenic
1011110586 6:83833456-83833478 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1011218925 6:85033776-85033798 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1011461994 6:87614355-87614377 CATCACAAGCCTGGAGACCTAGG - Intronic
1011933012 6:92737770-92737792 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1012068265 6:94577557-94577579 CATCACAAGCCTGGAGACCTAGG - Intergenic
1012070260 6:94604931-94604953 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1012118476 6:95334279-95334301 CATCATAAGCCTTGAGGCCTAGG - Intergenic
1012125317 6:95420981-95421003 CTTCACAGGCCTGCAGGCCTAGG - Intergenic
1012254395 6:97015792-97015814 CATCAGAGGCATGGAGGCCTAGG + Intronic
1012403973 6:98872768-98872790 CTTCAGAAGCCAGATGGCCTGGG + Exonic
1012478254 6:99637845-99637867 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1012826408 6:104151855-104151877 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1012830765 6:104201371-104201393 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1012883253 6:104816279-104816301 TGTCAGAGGCCTGGAGGCCTAGG + Intronic
1013086602 6:106863012-106863034 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1013338629 6:109191527-109191549 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1013802160 6:113959662-113959684 CTCCAGAACCATGAAAGCCTAGG + Intronic
1014143660 6:117971858-117971880 CATCACAGGCCTGGAGGCCTAGG - Intronic
1014154154 6:118092257-118092279 CATCACAGGCCTGGAGGCCTAGG + Intronic
1014369504 6:120586869-120586891 CATCAGAAGCATGCAAGCCTTGG + Intergenic
1014407425 6:121068908-121068930 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1014469951 6:121801630-121801652 CATCAGAAGCCTGAAGGCCTAGG + Intergenic
1014562982 6:122913705-122913727 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1014771753 6:125465466-125465488 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1015674154 6:135726023-135726045 CATTACAGGCCTGAAGGCCTAGG + Intergenic
1015713163 6:136163473-136163495 CATCACAGGCCTGGAGGCCTAGG - Intronic
1016122719 6:140363959-140363981 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1016142289 6:140627194-140627216 CTTCATAGGCCTGGAGGCCTAGG - Intergenic
1016411221 6:143785916-143785938 CATCACAGGCCTGAAGGCCCAGG - Intronic
1016523003 6:144967746-144967768 CTTCAGGAGCGTGAAGTGCTTGG - Intergenic
1016589458 6:145728876-145728898 CACCACAAGCCTGGAGGCCTAGG + Intronic
1017525433 6:155237839-155237861 CATCACAGGCCTGGAGGCCTAGG - Intronic
1017654482 6:156614217-156614239 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1018019659 6:159748584-159748606 CTTCAGAGGCCTGATGGCGTCGG + Intronic
1018155662 6:160983279-160983301 CATTACAGGCCTGAAGGCCTAGG + Intergenic
1018502086 6:164422312-164422334 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1018516152 6:164581801-164581823 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1019094154 6:169565070-169565092 CCTCAGAAGCCTCCCGGCCTGGG + Intronic
1019150463 6:170002015-170002037 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1019448521 7:1083923-1083945 CTTCAGAAGCACGCAGGCCGTGG - Intronic
1019656073 7:2196750-2196772 CTTCAGAAGTCAGAAGGCCTCGG + Intronic
1020057587 7:5128566-5128588 CTTCAGCAGCCTTTAGCCCTTGG - Intergenic
1020169938 7:5837415-5837437 CTTCAGCAGCCTTTAGCCCTTGG + Intergenic
1020493844 7:8822502-8822524 CATCACAAGCCTGGAGGCCTAGG - Intergenic
1020755585 7:12198546-12198568 CTTCTTAAGCATTAAGGCCTAGG - Intergenic
1021519639 7:21526613-21526635 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1021646789 7:22796637-22796659 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1022706039 7:32802713-32802735 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1022818232 7:33933795-33933817 CTTCTGCATCCTGAATGCCTGGG + Intronic
1023188589 7:37555701-37555723 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1023642802 7:42277590-42277612 GTTCAGGTGCCTGAGGGCCTCGG - Intergenic
1023980219 7:45065268-45065290 CCTCAGTGGCCTGAATGCCTGGG - Intronic
1024415951 7:49107587-49107609 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1024487125 7:49931790-49931812 CATCACAGGCCTGGAGGCCTAGG + Intronic
1024699266 7:51889563-51889585 CTTCATGAGTCTCAAGGCCTTGG - Intergenic
1025038521 7:55619065-55619087 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1027341193 7:77209957-77209979 CATCACAGGCCTGGAGGCCTAGG - Intronic
1027561173 7:79732170-79732192 CTTCAGAAGCCAGGAGTCTTTGG + Intergenic
1027586726 7:80066849-80066871 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1027605401 7:80292904-80292926 CATCACAAGCCTGGAGGCCTAGG - Intergenic
1027990964 7:85360674-85360696 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1028516317 7:91681244-91681266 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1030415439 7:109238005-109238027 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1030527691 7:110673360-110673382 CATCACAGGCCTGGAGGCCTAGG - Intronic
1030584385 7:111399468-111399490 CTTCAGCCACCTGAATGCCTGGG + Intronic
1030807203 7:113932567-113932589 CATCACAGGCCTGGAGGCCTAGG - Intronic
1030986246 7:116245048-116245070 CATCACAGGCCTGGAGGCCTAGG - Intronic
1031158138 7:118135217-118135239 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1031238641 7:119210700-119210722 CATCACAAGCCTCAAGGCCTTGG + Intergenic
1031282168 7:119818536-119818558 CATCAAAGGCCTGGAGGCCTAGG + Intergenic
1031301575 7:120067893-120067915 CTTCACAAGCCTAGAGGCCTAGG + Intergenic
1031435649 7:121728891-121728913 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1031573075 7:123383270-123383292 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1031576180 7:123418048-123418070 CATCACAGGCCTGAAAGCCTGGG - Intergenic
1031608199 7:123794436-123794458 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1031818736 7:126472736-126472758 CATCACAGGCCTGGAGGCCTGGG + Intronic
1032432754 7:131875295-131875317 CTTCAGATGCCTGGACTCCTTGG + Intergenic
1032454005 7:132058192-132058214 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1032803334 7:135333963-135333985 CATCAGAAGGCAGAAGGACTGGG + Intergenic
1032925804 7:136603709-136603731 CATCACAAGCCAGGAGGCCTAGG + Intergenic
1033072806 7:138220450-138220472 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1033356240 7:140602335-140602357 CTGCAGAAGCCAGCAGGGCTGGG - Exonic
1033760031 7:144427757-144427779 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1034431849 7:151045153-151045175 GTTCTGAAGCCTGCATGCCTTGG + Intronic
1034718407 7:153264652-153264674 CATCACACGCCTGGAGGCCTAGG - Intergenic
1034728892 7:153366100-153366122 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1034740052 7:153465596-153465618 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1034751289 7:153571375-153571397 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1034876192 7:154726584-154726606 CATCACAGGCCTGGAGGCCTAGG - Intronic
1034983014 7:155490401-155490423 CTTCTGAAGCATGAAGGCCTGGG - Intronic
1036277521 8:7368700-7368722 CCTCAAAGGCCTGGAGGCCTAGG + Intronic
1037048779 8:14342883-14342905 CTTCACAGGCCTGGAGGCCCAGG + Intronic
1037205968 8:16320638-16320660 CATCACAGGCCTGGAGGCCTAGG + Intronic
1037975593 8:23208964-23208986 CATCACAGGCCCGAAGGCCTAGG + Intronic
1038880499 8:31605661-31605683 CATCACAGGCCTGAAGGCCTAGG - Intergenic
1039107452 8:34004499-34004521 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1039121904 8:34157276-34157298 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1040091313 8:43401437-43401459 CATCAAAGGCCTGAAGGCTTAGG - Intergenic
1041413366 8:57581160-57581182 CTTGAGAAACAAGAAGGCCTTGG + Intergenic
1041494371 8:58469544-58469566 CTTCATATGCCTGGAAGCCTGGG + Intergenic
1041544286 8:59024462-59024484 TTTAAGAAGCATAAAGGCCTGGG - Intronic
1041849820 8:62378483-62378505 CATCACAGGCCTGGAGGCCTAGG + Intronic
1041889714 8:62855633-62855655 CTTCAGGAACCTGGAGGCCTTGG - Intronic
1042181107 8:66088344-66088366 CATCACAAGCCTGGAGGCCTAGG - Intronic
1042189856 8:66175178-66175200 GTCCAGAAAGCTGAAGGCCTGGG + Exonic
1042315200 8:67418991-67419013 CTTCACAAGCCTCCAGCCCTTGG + Intergenic
1043040223 8:75253415-75253437 CATCACAGGCCTAAAGGCCTAGG - Intergenic
1043241265 8:77938245-77938267 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1043373283 8:79618015-79618037 ATTCCGAAGCCAGATGGCCTGGG - Intronic
1043426062 8:80150028-80150050 CATCACAGGCCTGGAGGCCTAGG + Intronic
1043776682 8:84278376-84278398 CATCACAGGCCTGGAGGCCTAGG - Intronic
1043866915 8:85385236-85385258 TTTGTGAAGTCTGAAGGCCTGGG - Intronic
1044066607 8:87706495-87706517 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1044220483 8:89663674-89663696 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1044303893 8:90616381-90616403 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1044326873 8:90868917-90868939 CATCATAGGCCTGGAGGCCTAGG + Intronic
1044887478 8:96794471-96794493 CATTACAGGCCTGAAGGCCTAGG - Intronic
1045053647 8:98349883-98349905 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1045207368 8:100056471-100056493 CATCATAGGCCTGGAGGCCTAGG + Intronic
1045540059 8:103075792-103075814 CTTCACAAGCCTGAATGCAGAGG - Intergenic
1045617930 8:103939488-103939510 CATCACAGGCCTGGAGGCCTAGG - Intronic
1045884462 8:107079071-107079093 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1046226380 8:111285758-111285780 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1046243804 8:111532376-111532398 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1046880237 8:119299423-119299445 TATCACAGGCCTGAAGGCCTAGG - Intergenic
1047724777 8:127674556-127674578 CTTCAGATGACTGCAGCCCTAGG - Intergenic
1048107558 8:131427816-131427838 CATCACAGGCCTGAAGGCCTAGG - Intergenic
1048275545 8:133063031-133063053 CCCCAGAAGCCCAAAGGCCTCGG - Intronic
1048478963 8:134770033-134770055 CATCACAGGCCTGAAGGCCTAGG - Intergenic
1048668378 8:136689753-136689775 CATCACAGGCCTGGAGGCCTGGG - Intergenic
1049076261 8:140398883-140398905 CATCACAGGCCTGGAGGCCTAGG + Intronic
1050121526 9:2313678-2313700 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1051743937 9:20276964-20276986 CATCACAAGCCAGGAGGCCTAGG - Intergenic
1051914995 9:22198013-22198035 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1051946184 9:22572769-22572791 CATCACAGGCCTGCAGGCCTAGG + Intergenic
1051957412 9:22713025-22713047 CATCACAAGACTGGAGGCCTAGG + Intergenic
1052079114 9:24180788-24180810 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1052173857 9:25433057-25433079 CATCACAGGCCTGAAGGCGTAGG - Intergenic
1052187827 9:25620309-25620331 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1052294524 9:26882292-26882314 CATCACAGGCCTGGAGGCCTAGG + Intronic
1052382695 9:27788986-27789008 CATCACAAGCGTGGAGGCCTAGG + Intergenic
1052422283 9:28258850-28258872 CTTCTGAAACCTGAAAGCCTAGG + Intronic
1052594080 9:30536668-30536690 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1052625036 9:30963249-30963271 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1052969465 9:34368219-34368241 CATCACAGGCCTGGAGGCCTAGG - Exonic
1053389838 9:37726749-37726771 CTTAGGAAGCCTGAAGTCTTGGG + Intronic
1053479799 9:38407710-38407732 TTTCAGAGGCCTTCAGGCCTTGG + Intergenic
1055108541 9:72537213-72537235 CATCACAAGCCTAGAGGCCTAGG - Intronic
1055141946 9:72886538-72886560 CATCACAGGCCTGGAGGCCTTGG + Intergenic
1055363934 9:75524616-75524638 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1055553199 9:77450090-77450112 CTCCAGAATCCTGCAGCCCTGGG - Intronic
1055632942 9:78242399-78242421 ATTCTGAAGCCAGATGGCCTAGG + Intronic
1055774417 9:79752263-79752285 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1056527357 9:87455632-87455654 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1057064144 9:92033101-92033123 AATCTGCAGCCTGAAGGCCTCGG + Intronic
1057680385 9:97175812-97175834 ACACAGAAGCCAGAAGGCCTGGG + Intergenic
1058004619 9:99902049-99902071 CATCACAGGCCTGGAGGCCTTGG - Intergenic
1058230305 9:102417050-102417072 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1058269179 9:102948366-102948388 CTTGAGATATCTGAAGGCCTTGG - Intergenic
1058323040 9:103658307-103658329 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1058385313 9:104429206-104429228 CATCACAGGCCTGCAGGCCTAGG + Intergenic
1058466816 9:105237173-105237195 ATTCCGAAGACTGAAGGCTTTGG + Intergenic
1058980155 9:110161539-110161561 CGTCAGAACCCTGGGGGCCTGGG - Intronic
1059069547 9:111120718-111120740 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1059110820 9:111557011-111557033 CATCAAAGGCCTGGAGGCCTAGG - Intronic
1059674870 9:116528671-116528693 CATCACAAGCCTGGAGGCCTAGG + Intronic
1059885048 9:118736573-118736595 CATCACAAGCCTGGAGGCCTAGG + Intergenic
1060562540 9:124558309-124558331 TTTAAGGAGCCTGAAGCCCTAGG + Intronic
1060657360 9:125381107-125381129 CTCCAGACGCCTGAGGGACTGGG - Intergenic
1061753309 9:132795693-132795715 CTTCAGGAGCCCGGGGGCCTTGG - Intronic
1062438735 9:136559466-136559488 CATCACAGGCCTGGAGGCCTGGG + Intergenic
1062670053 9:137703199-137703221 CATCACAGGCCTGGAGGCCTAGG - Intronic
1185766994 X:2733351-2733373 TTTCAGATGGCTGAAGACCTAGG + Intronic
1186222682 X:7366429-7366451 CATCCCAGGCCTGAAGGCCTAGG + Intergenic
1187603715 X:20861266-20861288 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1188158877 X:26776231-26776253 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1188449532 X:30294813-30294835 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1188753870 X:33936333-33936355 CATCACAGGCCTGAAGGCCTAGG - Intergenic
1188781763 X:34294784-34294806 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1188794253 X:34442285-34442307 CATCACAAGCCAGGAGGCCTAGG - Intergenic
1189071345 X:37866875-37866897 CATCACAGGCCTGGAGGCCTAGG - Intronic
1189253772 X:39621493-39621515 TATCACAAGCCTGGAGGCCTAGG - Intergenic
1189382245 X:40510208-40510230 GGTCAGACACCTGAAGGCCTAGG - Intergenic
1189637243 X:43023826-43023848 CATCAGAAGCCCAGAGGCCTAGG - Intergenic
1190133422 X:47772138-47772160 CATCAGAAGACTGAAGTCATGGG - Intergenic
1190741049 X:53289025-53289047 CTTTAGAAGCCCTCAGGCCTGGG + Intronic
1190942785 X:55058761-55058783 CTTCAGAAACAGGAAGACCTGGG - Intergenic
1191749801 X:64529442-64529464 CTTCAGAAATCTTAGGGCCTTGG + Intergenic
1192008493 X:67242488-67242510 CATCACAGGCCTAAAGGCCTAGG + Intergenic
1192132664 X:68567524-68567546 CCTCACAGGCCTGGAGGCCTAGG - Intergenic
1192196199 X:69030037-69030059 CTTCTGAACACTGGAGGCCTGGG - Intergenic
1192309386 X:69997661-69997683 CATCACAGGCCTGGAGGCCTAGG + Intronic
1192335582 X:70216767-70216789 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1192659748 X:73029760-73029782 CTTCTGGAACCTGATGGCCTAGG + Intergenic
1192697923 X:73437679-73437701 CATCATAAGCTTGGAGGCCTAGG - Intergenic
1193008093 X:76643755-76643777 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1193143565 X:78054643-78054665 CCTCACAAACCTGGAGGCCTAGG - Intergenic
1193175625 X:78388886-78388908 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1193221267 X:78929298-78929320 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1193277498 X:79606309-79606331 CTTTACAAGCCTGAAGGGTTTGG + Intergenic
1193406397 X:81107198-81107220 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1193412662 X:81183338-81183360 CATCACAGGCCTGGAGGCCTAGG + Intronic
1193459770 X:81776112-81776134 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1193492005 X:82162039-82162061 CCTCACATGCCTGGAGGCCTAGG + Intergenic
1193509172 X:82378215-82378237 CATCACAGGCCTGAAGGTCTAGG - Intergenic
1193529893 X:82643416-82643438 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1193593949 X:83422997-83423019 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1193807961 X:86016380-86016402 CATCACAGGCCTGCAGGCCTAGG + Intronic
1193865791 X:86728581-86728603 CATCACAAGCCTAGAGGCCTAGG + Intronic
1193930048 X:87542382-87542404 CATCACAGGCCTGGAGGCCTAGG + Intronic
1193938534 X:87652208-87652230 CATCACAGGCCTGGAGGCCTAGG - Intronic
1193996019 X:88366543-88366565 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1194082949 X:89490406-89490428 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1194092893 X:89600364-89600386 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1194108249 X:89798536-89798558 CTTCAGACCATTGAAGGCCTGGG + Intergenic
1194220426 X:91183128-91183150 CATCACAAGCTTGGAGGCCTAGG + Intergenic
1194303002 X:92210076-92210098 CATCACAGACCTGAAGGCCTGGG - Intronic
1194473917 X:94335410-94335432 CTTCACAGGCCTGGAGGCCCAGG + Intergenic
1194563147 X:95447598-95447620 CATCACATGCCTGGAGGCCTGGG - Intergenic
1194838629 X:98713145-98713167 CATCACAAGTCTGGAGGCCTAGG + Intergenic
1194843571 X:98775867-98775889 CATCACAAGCCAGGAGGCCTAGG + Intergenic
1195455980 X:105070281-105070303 CTAGAGAAGCCTGAAGGGTTGGG - Intronic
1195681009 X:107546665-107546687 CTGCAGATTCCTGAAGGACTCGG - Intronic
1196060155 X:111399449-111399471 CTTCAGAAGGCTGAAGGCACAGG + Intronic
1196173605 X:112616745-112616767 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1196366806 X:114932751-114932773 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1196390687 X:115204267-115204289 CATCACAGGCCTGGAGGCCTAGG - Intronic
1196391292 X:115210222-115210244 CATCACAGGACTGAAGGCCTAGG + Intronic
1196973912 X:121138166-121138188 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1197049720 X:122043714-122043736 CTTCACAAGCCAGAAGGGATTGG - Intergenic
1197092522 X:122556035-122556057 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1197223092 X:123932207-123932229 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1197349833 X:125370103-125370125 CATCACAAGCATGAAGGCCTTGG - Intergenic
1197413098 X:126142277-126142299 CATCAGAAGCCCAAACGCCTAGG - Intergenic
1197437704 X:126452829-126452851 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1197595137 X:128455132-128455154 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1197642848 X:128985954-128985976 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1198274627 X:135089277-135089299 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1198857459 X:141033271-141033293 CATCATAGGCCTGGAGGCCTAGG + Intergenic
1198905237 X:141554100-141554122 CATCATAGGCCTGGAGGCCTAGG - Intergenic
1198966840 X:142236771-142236793 CATCAGAGGCCTGGAGGCTTAGG + Intergenic
1199070442 X:143469342-143469364 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1199106541 X:143875587-143875609 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1199134435 X:144234153-144234175 CATCACAAGCCTGGAGACCTAGG + Intergenic
1199346537 X:146747151-146747173 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1199357133 X:146875582-146875604 CCTCAGAGGCCTGGAGGCCTAGG + Intergenic
1199389368 X:147261992-147262014 CATCACAGGCCTGGAGGCCTAGG + Intergenic
1199400677 X:147395251-147395273 CATCATAGGCCTGAAGGTCTAGG + Intergenic
1199458754 X:148059599-148059621 TATCACAGGCCTGAAGGCCTAGG - Intergenic
1199681981 X:150231421-150231443 CTTCAGGAACCTGGAGGCCTTGG - Intergenic
1199776161 X:151013587-151013609 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1199942179 X:152637736-152637758 CTGCAGAAGCCTGAAGGGGCGGG + Intergenic
1200295413 X:154914264-154914286 CATCACAGGCCTGGAGGCCTAGG - Intronic
1200435600 Y:3146279-3146301 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1200445532 Y:3256467-3256489 CATCACAGGCCTGGAGGCCTAGG - Intergenic
1200460909 Y:3453272-3453294 CTTCAGACCATTGAAGGCCTGGG + Intergenic
1200496277 Y:3887210-3887232 CATCACAAGCATGGAGGCCTAGG - Intergenic
1200556937 Y:4646880-4646902 CATCACAAGCTTGGAGGCCTAGG + Intergenic