ID: 1069960067

View in Genome Browser
Species Human (GRCh38)
Location 10:72074222-72074244
Sequence GGGAGGCTTCAGAAGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1383
Summary {0: 1, 1: 0, 2: 4, 3: 101, 4: 1277}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069960067_1069960079 29 Left 1069960067 10:72074222-72074244 CCTTCAGGCTTCTGAAGCCTCCC 0: 1
1: 0
2: 4
3: 101
4: 1277
Right 1069960079 10:72074274-72074296 GGGTGAGGCCTCCTGGACAAAGG No data
1069960067_1069960075 8 Left 1069960067 10:72074222-72074244 CCTTCAGGCTTCTGAAGCCTCCC 0: 1
1: 0
2: 4
3: 101
4: 1277
Right 1069960075 10:72074253-72074275 TGGCAAGCGTCAGAGCAGGCAGG No data
1069960067_1069960074 4 Left 1069960067 10:72074222-72074244 CCTTCAGGCTTCTGAAGCCTCCC 0: 1
1: 0
2: 4
3: 101
4: 1277
Right 1069960074 10:72074249-72074271 AAGCTGGCAAGCGTCAGAGCAGG No data
1069960067_1069960076 9 Left 1069960067 10:72074222-72074244 CCTTCAGGCTTCTGAAGCCTCCC 0: 1
1: 0
2: 4
3: 101
4: 1277
Right 1069960076 10:72074254-72074276 GGCAAGCGTCAGAGCAGGCAGGG No data
1069960067_1069960078 22 Left 1069960067 10:72074222-72074244 CCTTCAGGCTTCTGAAGCCTCCC 0: 1
1: 0
2: 4
3: 101
4: 1277
Right 1069960078 10:72074267-72074289 GCAGGCAGGGTGAGGCCTCCTGG No data
1069960067_1069960077 14 Left 1069960067 10:72074222-72074244 CCTTCAGGCTTCTGAAGCCTCCC 0: 1
1: 0
2: 4
3: 101
4: 1277
Right 1069960077 10:72074259-72074281 GCGTCAGAGCAGGCAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069960067 Original CRISPR GGGAGGCTTCAGAAGCCTGA AGG (reversed) Intronic
900228299 1:1543144-1543166 GGGTGGCTACAGAAGCCTTGGGG + Intronic
900334870 1:2157643-2157665 GGGAGGCTGCAGAGGGCAGATGG - Intronic
900663939 1:3800957-3800979 GGGAGGCCTCAGAATCATGACGG + Intergenic
900686322 1:3950324-3950346 GGGAGGCTTCATAATCATGGTGG - Intergenic
900771928 1:4552231-4552253 GGGAGGCCTCAGAATCATGGTGG + Intergenic
900859660 1:5219092-5219114 GGGAGGCTTCACAATCATGGTGG - Intergenic
900951384 1:5859955-5859977 GGGCGGCTTCTGTAGCATGACGG + Intergenic
901214010 1:7544154-7544176 GGGAGGCCTCAGAATCATGGTGG + Intronic
902154889 1:14477293-14477315 GGGAGGCTTCACAATCATGGCGG - Intergenic
902271102 1:15305782-15305804 GGGAGGCCTCAGAATCATGGTGG - Intronic
902273406 1:15322923-15322945 GGGAGGCCTCAGAATCATGGCGG + Intronic
902456572 1:16537662-16537684 GGGAGGCCTCAGAATCATGGCGG + Intergenic
902474085 1:16671598-16671620 GGGAGGCCTCAGAATCATGGCGG + Intergenic
902484718 1:16735844-16735866 GGGAGGCCTCAGAATCATGGCGG - Intergenic
902495592 1:16870249-16870271 GGGAGGCCTCAGAATCATGGCGG - Intronic
902740335 1:18433488-18433510 GGGAGGCCTCAGAATCATGGCGG - Intergenic
903054920 1:20629249-20629271 GGGAGGCCTCAGAATCATGGCGG + Intergenic
903059268 1:20658259-20658281 GGGAGCCTTCCGATGCCAGAGGG + Intronic
903146659 1:21377114-21377136 GGGAGGCCTCAGAATCATGGCGG - Intergenic
903611442 1:24617626-24617648 GGGAGGCCTCACAATCCTGGTGG + Intergenic
904048710 1:27625136-27625158 GGGAGGGGTCAGAGACCTGAGGG + Exonic
904278177 1:29397712-29397734 GAGAGGCTGCACAAGCCTGGAGG - Intergenic
904383773 1:30128584-30128606 GGGAGGCTTCACAATCATGGTGG - Intergenic
904386288 1:30144446-30144468 GGGAGGCCTCAGAATCATGGCGG + Intergenic
904927908 1:34062938-34062960 GGGAGGCCTCAGAATCATGGTGG + Intronic
905230006 1:36509222-36509244 GGGAGGCTTCACAATCATGGTGG + Intergenic
906020668 1:42626810-42626832 GGGAGGCCTCAGAATCATGACGG - Intronic
906020940 1:42628727-42628749 GGGAGGCCTCAGAATCATGGTGG - Intronic
906372754 1:45268582-45268604 GGGAGGCCTCAGAATCATGATGG - Intronic
906373093 1:45270845-45270867 GGGAGGCCTCAGAATCATGGTGG - Intronic
906760997 1:48378531-48378553 GGGAGGCCTCAGAATCATGGTGG + Intronic
907392382 1:54166698-54166720 GGGAGGCCTCAGAATCATGGCGG + Intronic
907439407 1:54469694-54469716 GGGAGGCCTCAGAATCATGGCGG - Intergenic
907691971 1:56677894-56677916 GGGAGGCTGCGGCAGGCTGATGG - Intronic
907914540 1:58856568-58856590 GGGAGGCCTCAGAATCATGGTGG - Intergenic
908091175 1:60686814-60686836 GGGAGGCCTCATAATCATGACGG - Intergenic
908765887 1:67554405-67554427 GGGAGGCCTCAGAATCATGGTGG - Intergenic
908815949 1:68034464-68034486 GGGAGGCCTCAGAATCATGGTGG + Intergenic
908853235 1:68395114-68395136 GGGAGGCCTCAGAATCATGATGG + Intergenic
908853510 1:68397005-68397027 GGGAGGCCTCAGAATCATGGTGG + Intergenic
908923222 1:69221655-69221677 AGCAGGCTTCAGAAGCCAGGGGG + Intergenic
909054367 1:70804817-70804839 GAGAGGCTTCACAATCCTGGTGG - Intergenic
909253209 1:73384550-73384572 GGGAGGCCTCAGAATCATGGTGG + Intergenic
909407829 1:75312204-75312226 GGGAGGCTTCACAATCATGGTGG - Intronic
909681139 1:78293607-78293629 GGGAGGCCTCAGAATCATGGTGG - Intergenic
909956652 1:81787123-81787145 GGGAGGCTTCAGAATCATGGCGG - Intronic
910140491 1:84021946-84021968 GGGAGGCCTCAGAATCATGGTGG + Intergenic
910746828 1:90583303-90583325 GGGAGGCCTCAGAATCATGGCGG - Intergenic
910774384 1:90860947-90860969 GGGAGGCCTCAGAATCATGGCGG + Intergenic
910850105 1:91641684-91641706 GGGAGGCCTCAGAATCATGGCGG - Intergenic
911032462 1:93504405-93504427 GGGAGGCTTCAGACTCATGGCGG - Intronic
911358373 1:96848241-96848263 GGGAGGCCTCAGAATCATGGAGG - Intergenic
911612030 1:99968429-99968451 GGGAGGCCTCAGAATCATGGCGG + Intergenic
911753414 1:101524917-101524939 TGGAGTCTCCAGAAGCTTGAAGG - Intergenic
911907730 1:103590564-103590586 GGGAGGCCTCACAATCATGATGG - Intergenic
911968440 1:104398098-104398120 GGGAGTTTTCAGGAGTCTGATGG + Intergenic
912606965 1:111001283-111001305 GGGAGGCCTCACAATCATGATGG - Intergenic
912938104 1:114021255-114021277 GGGAGGCCTCAGAACCATGGTGG - Intergenic
913004636 1:114616925-114616947 GGGAGGCCTCAGAATCATGGTGG + Intronic
913081700 1:115394529-115394551 GGGAGGCCTCAGAATCATGGCGG + Intergenic
913098256 1:115540071-115540093 GGGAGGCCTCAGAATCATGGCGG + Intergenic
913242217 1:116838925-116838947 GGGAGGCTTCACAATCATGGTGG - Intergenic
913277918 1:117157397-117157419 GGGAGGCCTCAGAATCATGGAGG + Intronic
913616084 1:120560309-120560331 GGGAGGCTTCAGGAAGGTGAAGG - Intergenic
913955571 1:143288183-143288205 GGGAGACTTCAGAAGGCAAAAGG + Intergenic
913971556 1:143421421-143421443 GTGAGGCTGCAGCACCCTGAAGG - Intergenic
913981862 1:143527258-143527280 GGGAGACTTCAGAAGGCAAAAGG - Intergenic
914065933 1:144247034-144247056 GTGAGGCTGCAGCACCCTGAAGG - Intergenic
914076225 1:144353914-144353936 GGGAGACTTCAGAAGACAAAAGG - Intergenic
914102953 1:144612582-144612604 GGGAGACTTCAGAAGACAAAAGG + Intergenic
914113218 1:144719320-144719342 GTGAGGCTGCAGCACCCTGAAGG + Intergenic
914982711 1:152429309-152429331 GGGAGGCCTCAGAATCATGGCGG - Intergenic
915336008 1:155142005-155142027 GGGAGGCCTCAGAATCATGGCGG - Intergenic
916533519 1:165680918-165680940 GGGAGGCCTCAGAATCATGGCGG + Intronic
916544070 1:165785538-165785560 GGGAGGCCTCAGAATCTTGGTGG + Intronic
916814274 1:168336780-168336802 GGGAGGCCTCAGAATCATGGCGG + Intergenic
916814564 1:168338732-168338754 GGGAGGCCTCAGAAGCATGGTGG + Intergenic
916857163 1:168761832-168761854 GGGAGGCCTCACAACCATGATGG + Intergenic
917100496 1:171440281-171440303 GGGAGGCCTCAGAATCATGGTGG + Intergenic
917547191 1:175983432-175983454 GGGAGGCTTCACAATCATGGCGG - Intronic
917895179 1:179480270-179480292 GGGAGGCCTCATAATCCTGGTGG + Intronic
918015390 1:180628653-180628675 GGGAGGCTTCACAATCATGGTGG + Intergenic
918120053 1:181530240-181530262 GGGAGGCCTCAGAATCATGATGG - Intronic
918127878 1:181600234-181600256 GGGAGGCTTGAGCACTCTGAGGG + Intronic
918831431 1:189404386-189404408 GGGAGGCCTCACAATCATGATGG + Intergenic
919040836 1:192386097-192386119 GGGAGGCCTCACAATCATGATGG - Intergenic
919308635 1:195877551-195877573 GGGAGGCCTCAGAATCATGGCGG + Intergenic
919460398 1:197871091-197871113 GGGAGGCCTCAGAATCATGGCGG + Intergenic
919543287 1:198878448-198878470 GGGAGGCTGCACAATCATGATGG - Intergenic
919731318 1:200915338-200915360 GGGAGGATGCAGGAGGCTGAAGG + Intronic
919821593 1:201476463-201476485 GGGTGGGTGCAGAAGCCTGAAGG - Intergenic
919900067 1:202037635-202037657 GGGAGGCCTCAGAATCATGGTGG - Intergenic
920033793 1:203052659-203052681 GAGAGGCTGCAGGAGCCTGAAGG + Intronic
920040284 1:203091002-203091024 GTGTGGCTTCAGAGGCCTGGTGG - Intronic
920860157 1:209699356-209699378 GGGAGGCCTCAGAATCATGGTGG + Intronic
920860440 1:209701248-209701270 GGGAGGCCTCAGAATCATGGCGG + Intronic
921000445 1:211038296-211038318 GGGAGGCCTCAGAATCATGGTGG - Intronic
921089575 1:211830449-211830471 GGGAGGCGGCAGCGGCCTGAGGG - Intronic
921309075 1:213824981-213825003 GGGAGGGGGCAGAAGCCTGCTGG - Intergenic
921519093 1:216137332-216137354 GGGAGGCCTCAGAATCATGGTGG + Intronic
921891609 1:220359403-220359425 GGGAGGCCTCACAAGCATGATGG - Intergenic
922662985 1:227446580-227446602 GGGAGGCCTCACAATCATGAGGG + Intergenic
923198139 1:231687326-231687348 GGGAGGCCTCAGAATCATGGCGG + Intronic
923297710 1:232611180-232611202 GGGAGGCCTCAGAATCATGGCGG - Intergenic
923330835 1:232923170-232923192 GGGAGGCCTCAGAATCATGGTGG + Intergenic
923578615 1:235185743-235185765 GGAAGGATTCAGAACTCTGAAGG - Intronic
923794639 1:237142163-237142185 GGGTGGCTCCAGCAGCCTGAGGG + Intronic
923917584 1:238526468-238526490 GGGAGGCCTCAAAACCATGATGG - Intergenic
923919186 1:238545148-238545170 GGGAGGCCTCAGAATCATGGTGG + Intergenic
924504278 1:244666826-244666848 GGGAGGCCTCAGAATCATGGCGG + Intronic
924542897 1:244997986-244998008 GGGTGGCTTCAGTAGCCAGGTGG + Intronic
924806414 1:247365246-247365268 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1062793523 10:324812-324834 GGCACGCTTCAGAAGCCTTGTGG + Intronic
1062808293 10:441669-441691 GGGAGGCCTCAGAATCATGGTGG - Intronic
1063110790 10:3035475-3035497 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1063543849 10:6961316-6961338 GGGAGGCTTCACAATCATGGTGG + Intergenic
1063681191 10:8189284-8189306 GGGAGGTTTCAGAAACAGGAAGG + Intergenic
1063910039 10:10820154-10820176 GCGAGGCTTCAGAATCATGGCGG - Intergenic
1064133729 10:12732493-12732515 GGGAGGCCTCAGAATCGTGGCGG + Intronic
1064321502 10:14309712-14309734 GGGAGGCATACGGAGCCTGAGGG - Intronic
1064337652 10:14458269-14458291 GGGAGGCCTCACAATCCTGGTGG - Intronic
1064777191 10:18792059-18792081 GGGAGGCCTCACAATCATGATGG + Intergenic
1064907137 10:20358855-20358877 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1065347869 10:24765946-24765968 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1065602594 10:27384940-27384962 GGGAGGCCTCATAATCATGATGG - Intergenic
1065852495 10:29802438-29802460 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1066426755 10:35314280-35314302 GGGAGGCTTCACAATCATGGTGG + Intronic
1066599744 10:37092377-37092399 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1066600327 10:37098957-37098979 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1067363868 10:45606976-45606998 GGGAGGCCTCACAATCATGATGG - Intergenic
1067812048 10:49437198-49437220 GGGAGGCTTCATAATCATGGCGG - Intergenic
1067812147 10:49438313-49438335 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1068024181 10:51622319-51622341 GGGAAGGTAAAGAAGCCTGAAGG - Intronic
1068118342 10:52759279-52759301 GGGAGGGGTCAGAAGCAGGAAGG + Intergenic
1068225344 10:54101223-54101245 GGGAGGCTTCACAATCATGGTGG - Intronic
1068264843 10:54633197-54633219 GGGAGCCTGCATAATCCTGAAGG + Intronic
1068354671 10:55896448-55896470 GGGAGGGCTCAGAATCATGATGG + Intergenic
1068519255 10:58061280-58061302 GGGAGGGTTCAGAATCATGGCGG + Intergenic
1069239775 10:66124667-66124689 GGGAGGCCTCACAATCATGAAGG + Intronic
1069281585 10:66661269-66661291 GGGAGGCCTCAGAATCATGGCGG + Intronic
1069350581 10:67521539-67521561 GGGACGCTTCAGAGGCATAAAGG - Intronic
1069960067 10:72074222-72074244 GGGAGGCTTCAGAAGCCTGAAGG - Intronic
1070148209 10:73789710-73789732 GGCAGACTGCAGAAGCCTGAAGG - Exonic
1070226888 10:74516949-74516971 GGGAGGCCTCAGAATCATGGTGG + Intronic
1070407576 10:76110742-76110764 GGGAGGCCTCAGAATCATGGTGG - Intronic
1070655549 10:78268776-78268798 GGGAGGCTTCATAATCATGGTGG + Intergenic
1070767462 10:79065098-79065120 GGGAGGCTTGAGGTCCCTGAGGG - Intergenic
1070958915 10:80485462-80485484 CGGAGGCTTCAGAACCCCAAGGG - Intronic
1071395289 10:85217690-85217712 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1071442688 10:85717365-85717387 GGGAGGCCTCAGAATCATGATGG + Intronic
1072049936 10:91693506-91693528 GGGAGGCCTCACAATCATGATGG + Intergenic
1073790703 10:106937567-106937589 GGGAGGCTTCACAATCATGGTGG - Intronic
1074199707 10:111223967-111223989 GGGAGGCCTCACAATCATGATGG - Intergenic
1074237713 10:111602724-111602746 GGGAGGCCTCACAATCATGATGG - Intergenic
1074287339 10:112110537-112110559 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1074297047 10:112199698-112199720 GGGAGGCCTCACAATCATGATGG + Intronic
1074619757 10:115106741-115106763 GGGAGGCCTCAGAATCATGGTGG - Intronic
1074662517 10:115677634-115677656 GGGAGGCCTCAGAATCATGGCGG - Intronic
1074665742 10:115721491-115721513 GGGAGGCCTCAGAATCATGGTGG + Intronic
1074910347 10:117902888-117902910 GGGAGGCCTCACAAGCATGGTGG + Intergenic
1074918756 10:117985172-117985194 GGAAGGCCTCAGAATCATGATGG - Intergenic
1074966825 10:118498174-118498196 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1075446292 10:122515766-122515788 GGGAGGCTGCGGAAGGCCGAAGG + Intergenic
1075509122 10:123055225-123055247 GGGAGGCCTCAGAATCATGGTGG + Exonic
1075509253 10:123056273-123056295 GGGAGGCCTCAGAATCATGGCGG + Exonic
1075509358 10:123057518-123057540 GGCAGGCTTCAGGAGGCTGATGG - Exonic
1075543512 10:123336355-123336377 GGGAGGCTTCAGAATCATGGTGG + Intergenic
1075543800 10:123338265-123338287 GGGAGGCTTCAGAATCACGGTGG + Intergenic
1075612773 10:123866631-123866653 GGCAGGCCTCAGAACCCTGGAGG + Intronic
1075651889 10:124132660-124132682 GGGCGGGGTCTGAAGCCTGAGGG + Intergenic
1076355602 10:129850715-129850737 GGGAGGCTTCTGATCACTGAAGG + Intronic
1076464679 10:130670919-130670941 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1077193241 11:1264817-1264839 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1077362055 11:2145162-2145184 GGGAGGCTGCAGAAGGCTGGTGG - Intronic
1077575644 11:3381007-3381029 GGGAGGCCTCAGAATCATGACGG - Intergenic
1078146948 11:8728574-8728596 GGGAGAGTTCATCAGCCTGAAGG - Intronic
1078199606 11:9168388-9168410 GGGAGGCTTCACAATCATGGTGG - Intronic
1078408169 11:11089373-11089395 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1078482084 11:11686583-11686605 GGGAGGCTTCAGAATCATGGTGG - Intergenic
1078482367 11:11688505-11688527 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1078496848 11:11825849-11825871 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1078553770 11:12301027-12301049 GGGAGGCCTCAGAATCATGGCGG + Intronic
1078688395 11:13554477-13554499 GGGAGGCCTCACAATCATGATGG + Intergenic
1078713074 11:13813884-13813906 TGGAGGCCTCAGAATCATGATGG + Intergenic
1078993495 11:16672475-16672497 GGGAGGCCTCACAATCATGATGG + Intronic
1079701411 11:23553206-23553228 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1079728786 11:23913939-23913961 GGGAGGCTTCACAATCATGGTGG + Intergenic
1079736974 11:24009552-24009574 GAGAGGCTTCAGAAGATTTAAGG + Intergenic
1079828159 11:25225598-25225620 GGGAGGCTTCACAATCATGGTGG + Intergenic
1079945036 11:26731695-26731717 GGGAGTCTTCACAAGCATGGTGG - Intergenic
1079991107 11:27248192-27248214 GGAAGGCACAAGAAGCCTGAAGG + Intergenic
1080153245 11:29077767-29077789 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1080238467 11:30099141-30099163 GGGAGGCCTCACAATCATGATGG + Intergenic
1080338199 11:31224112-31224134 GGGAGGCCTCAGAATCATGAAGG - Intronic
1080423316 11:32132705-32132727 GGGAGGCTTCACAATCATGGTGG - Intergenic
1080739194 11:35048165-35048187 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1080817591 11:35773157-35773179 GGGAGGCCTCAGAATCATGGCGG - Intronic
1081383988 11:42448944-42448966 TGGAGGCTTCACAAGTGTGAAGG - Intergenic
1081400225 11:42635065-42635087 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1081400575 11:42637310-42637332 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1081411630 11:42765533-42765555 GGGAGGCCTCACAATCATGATGG + Intergenic
1081580599 11:44348977-44348999 TGGAGGCTTCACAGGCCTGCGGG + Intergenic
1081598874 11:44478050-44478072 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1082229289 11:49744285-49744307 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1083098351 11:60277057-60277079 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1083500624 11:63104614-63104636 GGGAGGCCTCAGAATCATGGTGG + Intronic
1084155399 11:67310275-67310297 GGAGGGCTCCAGAAGACTGATGG - Exonic
1084660696 11:70544788-70544810 TTGTGGCATCAGAAGCCTGAGGG - Intronic
1085341599 11:75735003-75735025 GTGAGGGTTCAGAAGCAGGAAGG + Intergenic
1085754908 11:79194175-79194197 GGGAGGCCTCAGAATCATGGTGG - Intronic
1085807282 11:79648005-79648027 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1085890654 11:80574466-80574488 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1086323107 11:85671111-85671133 GGGAGGCTTCACAATCATGGTGG + Intronic
1086562749 11:88187119-88187141 GGGAGGCCTCACAATCATGATGG - Intergenic
1086620791 11:88884840-88884862 GGGAGGCCTCAGAATCATGGCGG - Intronic
1086721537 11:90127630-90127652 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1086759086 11:90604091-90604113 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1086794431 11:91083126-91083148 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1086995876 11:93354598-93354620 GGGAGGCCTCAGAATCATGGGGG + Intronic
1087189398 11:95236495-95236517 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1087447816 11:98276973-98276995 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1087723218 11:101690348-101690370 GGGAGGCCTCAGAAACATGGCGG + Intronic
1087725303 11:101708835-101708857 GGGAGGCTTCACAATCATGGTGG - Intronic
1087942594 11:104116909-104116931 GGGAGGCCTCAGAATCATGGAGG - Intronic
1088111676 11:106268328-106268350 GGGAGGCTTCACAATCATGGTGG - Intergenic
1088377504 11:109158797-109158819 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1088869467 11:113878688-113878710 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1089116693 11:116100961-116100983 GGGAGGCTTCACAATCATGGTGG - Intergenic
1089352436 11:117829135-117829157 GGGCGGCTACAGGAACCTGACGG - Intronic
1089404976 11:118190451-118190473 GGGAGGCCTCTGAATCATGATGG - Intergenic
1090087518 11:123663698-123663720 GGGAGGCTTCACAATCATGGTGG + Intergenic
1090431303 11:126648996-126649018 GGGAGGCCTCAGAATCATGGAGG + Intronic
1090638786 11:128712562-128712584 GGGAGGCTTCACAATCATGGCGG + Intronic
1091086467 11:132726248-132726270 GGGAGGCTTCACAATCATGGTGG + Intronic
1091505108 12:1060136-1060158 GGGAGGCCTCAGAATCATGGTGG + Intronic
1091775127 12:3179464-3179486 TGGAGCCTTCAGATGCGTGAGGG + Intronic
1091838665 12:3603790-3603812 GGGAGGCCTCAGCACCCTGTTGG + Intergenic
1091848022 12:3672551-3672573 GGGATGGTTCATAACCCTGAAGG - Intronic
1091858762 12:3759973-3759995 GGGAGGCCTCAGAATCATGGTGG - Intronic
1092093744 12:5824812-5824834 GGGAGGCCTCAGAATCATGGTGG + Intronic
1093130852 12:15390361-15390383 GGGAGGCTTCACAATCATGGAGG + Intronic
1093230393 12:16536647-16536669 GGGAGGCCTCAGAATCATGGTGG + Intronic
1093324875 12:17760996-17761018 GGGAGGCCTCAGAATCATGAAGG + Intergenic
1093631728 12:21418500-21418522 GGGAGGCCTCATAATCATGATGG + Intronic
1093874900 12:24338835-24338857 GGGAGGCCTCACAATCATGATGG - Intergenic
1093978552 12:25450598-25450620 GGGAGGCCTCAGAATCATGACGG - Intronic
1094489378 12:30949406-30949428 GGGAGGCCTCAGAATCATGGTGG + Intronic
1095188960 12:39233830-39233852 GGGAGGCTTCACAAGCATGGTGG - Intergenic
1095235169 12:39786370-39786392 GGGAGGCCTCAGAATCATGGTGG - Intronic
1095514326 12:42989636-42989658 GGGAGGTTGCAGAACCCTCATGG - Intergenic
1095600851 12:44011532-44011554 GGGAGGCCTCACAATCATGACGG - Intronic
1095623087 12:44282150-44282172 GGGAGGCCTCAGAATCATGGTGG - Intronic
1095623406 12:44284346-44284368 GGGAGGCTTCAGAATCATGGTGG - Intronic
1095773354 12:45986866-45986888 GGGAGGCCTCAGAATCTTGGTGG - Intronic
1096838639 12:54367977-54367999 GGGAGGATTCAGAAGGATGCGGG - Intergenic
1096841637 12:54383452-54383474 GGGAAGCCTCAAAAGCCAGACGG - Intronic
1097325902 12:58276643-58276665 GGGAGGCCTCACAATCATGAAGG - Intergenic
1097707707 12:62885010-62885032 GGGAGGCCTCAGAATCATGGCGG + Intronic
1097757946 12:63427459-63427481 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1097797561 12:63880181-63880203 GGGAGGCTTCACAATCATGGCGG - Intronic
1097854383 12:64446993-64447015 GGGAGGCTTCACAATCATGTCGG + Intronic
1097999258 12:65922950-65922972 GGGAGGCCTCAGAATCATGGTGG - Intronic
1098078708 12:66760432-66760454 GGGAGGCCTCAGAATCATGGTGG + Intronic
1098578584 12:72072005-72072027 GGGAGGCTTCACAATCATGGTGG + Intronic
1098924381 12:76333505-76333527 GGGAGGCCTCAGAAGCATGGCGG - Intergenic
1099507923 12:83501239-83501261 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1099537419 12:83861757-83861779 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1099592819 12:84617596-84617618 GGGAGACCTCAGAATCATGATGG - Intergenic
1099700219 12:86074184-86074206 GGGAGGCCTCAGAATCATGGTGG - Intronic
1099819334 12:87690252-87690274 GGGAGGATTCAGAATCATGGTGG + Intergenic
1100074027 12:90756077-90756099 GGGAGGCTTCAGAATCATGGTGG - Intergenic
1100205645 12:92346045-92346067 GGGAGGCATCAGAATCATGGCGG - Intergenic
1100276633 12:93077457-93077479 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1100946258 12:99787382-99787404 GGGAGGCTTCACAATCATGGTGG - Intronic
1101111699 12:101492673-101492695 GGGAGGCTTCACAATCATGGCGG + Intergenic
1101222897 12:102659022-102659044 GGGAGGCCTCACAATCCTGGTGG + Intergenic
1101340114 12:103835907-103835929 GGGAGGCCTCAGAATCATGGCGG + Intronic
1101359179 12:104009883-104009905 GGGAGGCCTCAGAATCATGTGGG - Intronic
1101663407 12:106787588-106787610 GGGAGGCCTCAGAATCATGGTGG + Intronic
1101716034 12:107313415-107313437 GGGAGGCTTCACAATCATGGTGG + Intergenic
1102595991 12:113993002-113993024 GGGAGGCTTCACAATCATGGTGG - Intergenic
1102758626 12:115366080-115366102 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1102758913 12:115368013-115368035 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1103040865 12:117694411-117694433 GGGAGGCCTCACAAGCATGGTGG - Intronic
1103183602 12:118936585-118936607 GGGAGGCTTCACAATCATGGCGG - Intergenic
1103302015 12:119935021-119935043 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1103305506 12:119960855-119960877 GGGAGGCTTCACAATCATGATGG - Intergenic
1103614116 12:122141497-122141519 GGGAGGCTTCTGGAGGCAGAGGG + Intronic
1103880614 12:124163279-124163301 GGGAGGCCTCAGAATCATGGTGG + Intronic
1104039330 12:125119499-125119521 GGGAGGCCTCACAATCATGATGG + Intronic
1104208343 12:126662061-126662083 GGGAGGCTTCACAATCGTGATGG - Intergenic
1104212318 12:126700814-126700836 GGGAGGCCTCACAATCATGATGG - Intergenic
1104344950 12:127987509-127987531 GGCAGGCTTCAGAAGCCAAAGGG + Intergenic
1104413983 12:128582700-128582722 GGGAGGCCTCGGAATCATGATGG - Intronic
1104481163 12:129109720-129109742 GGGAGGCCTCAGAATCATGGCGG - Intronic
1104742611 12:131189410-131189432 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1105498693 13:20952957-20952979 CGGTGGCATCTGAAGCCTGAAGG - Intergenic
1105543049 13:21331272-21331294 AGGAGACTCCAGAAGCATGAGGG + Intergenic
1106121146 13:26861005-26861027 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1106262489 13:28079605-28079627 GGGAGGCTTCAAAATCATGGTGG + Intronic
1106485389 13:30167744-30167766 GGGAGGCCTCACAATCATGATGG - Intergenic
1106633185 13:31498598-31498620 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1106791822 13:33163026-33163048 GGGAGGCCTCAGAATCATGGCGG + Intronic
1107183052 13:37484720-37484742 GGGAGGCCTCACAATCATGATGG + Intergenic
1107541594 13:41394127-41394149 GGGAGGCCTCAGAATCATGATGG + Intergenic
1107961811 13:45565683-45565705 GGGAGGCCTCAGAATCATGGTGG - Intronic
1108538775 13:51415601-51415623 GGGAGGCCTCACAATCCTGGTGG - Intronic
1108686652 13:52825996-52826018 GGGAGGCCTCACAATCATGATGG - Intergenic
1108810516 13:54218408-54218430 GGGAGGCCTCACAATCATGATGG - Intergenic
1109150797 13:58844985-58845007 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1109221872 13:59647877-59647899 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1109285856 13:60408053-60408075 GGGAGGCCTCAGAATCATGGCGG - Intronic
1109285882 13:60408200-60408222 GGGAGGCCTCAGAATCATGGCGG - Intronic
1109286159 13:60410127-60410149 GGGAGGCCTCAGAATCATGGTGG - Intronic
1109475785 13:62878214-62878236 GGGAGGCGTCAGAATCATGGCGG + Intergenic
1109526418 13:63581396-63581418 GAGAGGCTTCAGAATCATGGCGG + Intergenic
1109702858 13:66049013-66049035 GGGAGGCCTCACAATCATGATGG + Intergenic
1109737433 13:66505297-66505319 GGGAGGCCTCACAATCATGATGG + Intronic
1109828583 13:67755753-67755775 GGGAGGCTTCACAACCATGGTGG - Intergenic
1109959700 13:69614297-69614319 GGGAGGCTTCAGAATCATGGCGG - Intergenic
1109987717 13:70011913-70011935 GGGAGGCTTCACAATCATGGTGG + Intronic
1110083240 13:71344766-71344788 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1110341798 13:74401582-74401604 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1110357093 13:74578997-74579019 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1110683243 13:78341420-78341442 GGGAGGCCTCAGAATCGTGGCGG + Intergenic
1110924474 13:81132632-81132654 GGGAGGCTTCACAATCATGGTGG - Intergenic
1111030353 13:82589655-82589677 GGGAGGCTTCACAATCATGGTGG - Intergenic
1111208784 13:85049730-85049752 GGGAGGCATCAGAATCATGGTGG + Intergenic
1111378901 13:87419888-87419910 GGGAGGCCTCACAATCCTGGTGG + Intergenic
1111498159 13:89081548-89081570 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1111614176 13:90643021-90643043 GGGAGGCCTCACAATCATGATGG + Intergenic
1111949060 13:94695483-94695505 GGGAGGCCTCACAATCATGATGG - Intergenic
1111986464 13:95071134-95071156 GGGAGGCCTCAGACTCATGATGG - Intronic
1112018715 13:95353035-95353057 GGGAGGTTTCGGAAAGCTGAGGG + Intergenic
1112253242 13:97803159-97803181 GGGAGGCCTCACAATCATGATGG - Intergenic
1112390786 13:98982101-98982123 GGAAGGCTTCAGAAGCAGGATGG + Intronic
1112410733 13:99161276-99161298 GGGAGGCCTCACAATCATGATGG + Intergenic
1112507776 13:99985337-99985359 GGGAGGATTCAGAGCCCTGCGGG - Exonic
1112979068 13:105358842-105358864 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1113005299 13:105694997-105695019 GGGAGGCCTCACAATCATGATGG - Intergenic
1113064681 13:106360868-106360890 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1113105102 13:106763321-106763343 GGGAGGCTTCACAATCATGGTGG - Intergenic
1113198074 13:107832952-107832974 GGGAGGCTACAGATGCCAGCAGG - Intronic
1114217328 14:20666724-20666746 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1114388814 14:22283656-22283678 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1114666303 14:24379044-24379066 GAGAGGCCCCACAAGCCTGAAGG - Exonic
1114712280 14:24790652-24790674 GGGAGGCTTCACAATCATGGCGG - Intergenic
1114812679 14:25918323-25918345 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1114975993 14:28100089-28100111 GGGAGGCCTCACAATCCTGGTGG - Intergenic
1115006999 14:28498282-28498304 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1115116043 14:29881364-29881386 GGGAGGCCTCAGAATCATGGTGG - Intronic
1115171596 14:30514206-30514228 GGGAGGCTTCACAATCATGGTGG + Intergenic
1115484213 14:33894071-33894093 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1116164001 14:41310669-41310691 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1116287046 14:42987006-42987028 GGGAGGCTTCAGAATCTTTACGG - Intergenic
1116448205 14:45036901-45036923 GGGAGGCCTCAGAATCATGGCGG + Intronic
1116713611 14:48399859-48399881 GGGAGGCCTCATAATCATGACGG - Intergenic
1117182112 14:53201446-53201468 GGGAGGCCTCAGAATCATGCCGG - Intergenic
1117186451 14:53245077-53245099 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1117745214 14:58862089-58862111 GGGAGGCTTCACAATCATGGTGG - Intergenic
1118057118 14:62090831-62090853 GGGAGGCCTCACAATCATGAAGG + Intronic
1118226055 14:63900363-63900385 GGGAGGCCTCACAATCATGATGG + Intronic
1118615368 14:67571556-67571578 GGGAGGCCTGAGAAGCATGGAGG + Intronic
1118657349 14:67967038-67967060 GGGAGGCCTCAGAATCATGGTGG + Intronic
1118661252 14:68015484-68015506 GGGAGGCTTCATAATCATGGTGG + Intronic
1118933636 14:70265476-70265498 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1118935803 14:70287012-70287034 GGGAGGCCTCAGAATCGTGGCGG - Intergenic
1119065208 14:71518862-71518884 GGGAGGCCTCAGAATCATGACGG + Intronic
1119101236 14:71881626-71881648 GGGAGGCCTCACAATCATGATGG - Intergenic
1119666913 14:76491440-76491462 GAGAGGCTTGAGAAGCCTGCAGG - Exonic
1120366895 14:83582623-83582645 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1120485009 14:85102401-85102423 GGGAGGCATCAGAATCATGGTGG + Intergenic
1120499086 14:85271621-85271643 GGGAGGCCTCACAATCATGACGG + Intergenic
1120524015 14:85556910-85556932 GGGAGGCCTCAGAATCATGGCGG + Intronic
1120665371 14:87300227-87300249 GGGAGGCTTCACAATCATGGTGG - Intergenic
1120809320 14:88786782-88786804 GGGAGGCCTCAGAATCATGGTGG - Intronic
1120831637 14:89002676-89002698 GGGAGCCTTCAGAATCATGGCGG + Intergenic
1120966108 14:90168986-90169008 GGGAGGCTTCACAATCATGGTGG - Intronic
1121483679 14:94297406-94297428 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1121483959 14:94299318-94299340 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1121654463 14:95585169-95585191 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1122047131 14:99032195-99032217 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1122436323 14:101702847-101702869 GGGAGGCCTCACAATCCTGGAGG - Intergenic
1122884888 14:104706507-104706529 GGTGGGCTTCAGAGGCCTCAGGG + Intronic
1124461764 15:29898312-29898334 GGGAGGCCTCACAATCATGATGG - Intronic
1125279139 15:38025960-38025982 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1125304342 15:38292513-38292535 GGGAGGCCTCAGAATCATGGTGG + Intronic
1125881544 15:43199914-43199936 GGGAGGCCTCAGAATCATGGCGG - Intronic
1126162968 15:45631193-45631215 GGGAGGCCTCAGAATCATGGAGG - Intronic
1126266657 15:46762916-46762938 GGGAGGTCTCAGAATCATGATGG - Intergenic
1126432318 15:48599027-48599049 GGGAGGCTTCATAATCATGGTGG - Intronic
1126781127 15:52139883-52139905 GAGGGGCTTCAGATGCCTGATGG + Intronic
1127145122 15:56015636-56015658 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1127362838 15:58260161-58260183 GGGAGGCCTCAGAATCATGGTGG - Intronic
1127529542 15:59830119-59830141 GGCAGCCTTCAGAACCCTGGTGG - Intergenic
1128118196 15:65125875-65125897 GGGAGGCTTCACAATCATGGCGG + Intronic
1128215640 15:65932488-65932510 TGGAGGCTTCAGAGGCCTTGAGG + Intronic
1128749029 15:70135274-70135296 GGGAGGCTTCACAATCATGGTGG + Intergenic
1129469311 15:75741738-75741760 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1129469606 15:75743656-75743678 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1129914474 15:79256705-79256727 GGGAGGCTTCACAATCATGGTGG + Intergenic
1130258019 15:82334806-82334828 GGAAGGCCTCGGAAGCCAGAGGG + Intergenic
1130376658 15:83335201-83335223 GGGAGGCCTCACAATCATGATGG - Intergenic
1130669055 15:85894134-85894156 GTGAGGCTTCTGAACCCTCATGG + Intergenic
1130730656 15:86488615-86488637 GGGATGTGTCAGAAGGCTGAAGG - Intronic
1130971101 15:88733352-88733374 GGGAGACTTCACAATCATGATGG - Intergenic
1131307812 15:91260757-91260779 GGGAGGCCTCAGAATCATGGCGG + Intronic
1131560671 15:93436783-93436805 GGGAGGCTTCACAATCATGGTGG + Intergenic
1131800237 15:96060826-96060848 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1132299824 15:100768572-100768594 AAAAGGCTGCAGAAGCCTGAGGG + Intergenic
1132388242 15:101417231-101417253 GGGAGGCGTCAGAATCATGGTGG - Intronic
1132855943 16:2044562-2044584 GAGAGACCTCAGAAGGCTGAGGG - Intronic
1133002816 16:2859702-2859724 TGGAGGCTTCGGGAGCCTGGAGG + Intergenic
1133867569 16:9658430-9658452 GGGATGCTTCAGAAGCACGAGGG + Intergenic
1134034048 16:11015972-11015994 GGGAGTCTTCAGATGTCTGATGG + Intronic
1134105013 16:11478979-11479001 GGGAGGCTTCAAAATCATGGTGG - Intronic
1134369497 16:13609803-13609825 GGGAAGCTTCAGAAGGCAGCTGG + Intergenic
1134542315 16:15077497-15077519 GGGAGGCCTCAGAATCATGGCGG - Intronic
1134583101 16:15388328-15388350 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1134584155 16:15396345-15396367 GAGCTGCTTCAGAGGCCTGAAGG + Intronic
1134885810 16:17790478-17790500 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1135164934 16:20130783-20130805 GGGAGGCCTCAAAATCATGATGG + Intergenic
1135913699 16:26583925-26583947 GTGAGGCATCAGTAGCCTCAGGG - Intergenic
1136192135 16:28622971-28622993 GAGCTGCTTCAGAGGCCTGAAGG - Intronic
1136193187 16:28631049-28631071 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1136628072 16:31473692-31473714 GGGAGTCTTCAGGAGCCTCGGGG + Exonic
1137223008 16:46474042-46474064 GGAAGGGATCAGAAGCCTTAGGG + Intergenic
1137482736 16:48865760-48865782 TGGGGGCTTCAGAAGCCACAGGG + Intergenic
1137609575 16:49809767-49809789 AGCAGGCTTCAGATGCCTCAGGG - Intronic
1137818414 16:51421341-51421363 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1137818707 16:51423247-51423269 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1137841028 16:51641010-51641032 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1138140128 16:54560738-54560760 GGGAGGCATCACAATCATGAAGG - Intergenic
1138899631 16:61253193-61253215 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1139126766 16:64088025-64088047 GGGAGGCTAGAGTAACCTGAAGG + Intergenic
1139240249 16:65384069-65384091 GGGAAGCTTCAGAATCATGGCGG - Intergenic
1139812905 16:69637506-69637528 GGGAGGCCTCAGAATCATGGTGG + Intronic
1139858785 16:70003480-70003502 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1139885903 16:70206628-70206650 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1140269645 16:73453746-73453768 GGGAGGCTTCACAATCATGGTGG + Intergenic
1140278222 16:73530111-73530133 GGGAGGCCTCACAAGCATGGTGG + Intergenic
1140487962 16:75309158-75309180 GGGAGGGCTCAGAACCCTGAGGG - Intronic
1140566091 16:76044141-76044163 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1140824356 16:78692041-78692063 GGGAGGCCTCAGAAACATGGTGG - Intronic
1141037659 16:80642640-80642662 GGGAGGCCTCAGAATCATGGAGG + Intronic
1141057908 16:80835710-80835732 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1141068350 16:80932089-80932111 GGGAGGCTGCAGGAGACTGGGGG + Intergenic
1141536955 16:84688464-84688486 GGGAGGCCTCATAAGCATGGCGG - Intergenic
1141843815 16:86593459-86593481 AGGAGCCTTCAGAAGCAGGAAGG - Intergenic
1142274256 16:89107972-89107994 GGGAGGCCTCAGAATCATGGTGG + Intronic
1143316066 17:6034416-6034438 GGGAGGCCTCAGAATCATGCCGG + Intronic
1144213495 17:13034687-13034709 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1146139765 17:30355575-30355597 GGGAGGCTGCAGAATTATGATGG + Intergenic
1146619525 17:34386650-34386672 ATGAGTCTTCAGAGGCCTGAGGG - Intergenic
1147496577 17:40922092-40922114 GGGAGGCCTCACAATCATGATGG - Intergenic
1147918339 17:43901508-43901530 TGGAGGCTGCAGTACCCTGATGG - Intronic
1148018709 17:44539839-44539861 GGGAGGCTTCGGAAGGTTGAAGG + Intergenic
1148145678 17:45363193-45363215 GGGAGGCCTCACAATCATGATGG - Intergenic
1149902508 17:60493142-60493164 GGGAGGCTTCACAATCATGGCGG - Intronic
1150092460 17:62339885-62339907 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1150416901 17:64995393-64995415 GGGAGGCTGCGGAAGCCTCATGG - Intergenic
1150508681 17:65725697-65725719 GGGAGGCCTCAGAATCATGGTGG + Intronic
1150623773 17:66828406-66828428 GGGAGGCCTCATAATCATGATGG + Intergenic
1150727784 17:67665763-67665785 GGGAAGCTTCAGAAGCAGAAAGG + Intronic
1150794767 17:68228532-68228554 GGGAGGCTGCGGAAGCCTCGTGG + Intergenic
1151099758 17:71543385-71543407 GGGAGGCCTCACAATCATGATGG + Intergenic
1151186883 17:72371257-72371279 GGGAGGGTCCAGAAGCCGCATGG - Intergenic
1151197155 17:72439761-72439783 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1151232106 17:72692452-72692474 GGGAGGCCTCAGAATCATGGCGG + Intronic
1151805125 17:76400345-76400367 GGGAGGCTTAAGAACACTGCTGG - Intronic
1152010056 17:77707456-77707478 GGGAGGCCTCACAATCGTGATGG - Intergenic
1152417426 17:80171680-80171702 TGGGGGCTCCAGAAGCCTGAGGG + Intronic
1152890877 17:82881033-82881055 GGGAGGCTTCTGAGGGCTGGGGG - Intronic
1152988085 18:337595-337617 GGGAGACTTTAGAAGACTTAGGG + Intronic
1152989566 18:350328-350350 GGGAGGCCTCAGAATCATGGTGG - Intronic
1153011791 18:546381-546403 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1153012115 18:548616-548638 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1153265630 18:3266187-3266209 GGGAGGCTGCAGTCGTCTGAAGG + Intronic
1153426722 18:4973924-4973946 GGGAGGCCTCAGAACCGTGGCGG + Intergenic
1153449565 18:5212018-5212040 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1153507963 18:5822342-5822364 GGGAGGCCTCACAATCATGATGG - Intergenic
1153577548 18:6537479-6537501 AGGAGGCCTCAGAATCATGATGG - Intronic
1153775016 18:8445133-8445155 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1153943755 18:10000314-10000336 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1154087525 18:11322062-11322084 GGGAGGCCTCACAATCATGATGG + Intergenic
1154312997 18:13281964-13281986 GGGAGGCCTCAGAATCATGACGG + Intronic
1154396817 18:13998387-13998409 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1155192118 18:23439223-23439245 GGGAGGCTTCATAATCATGGTGG - Intergenic
1155632262 18:27907158-27907180 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1155789761 18:29950845-29950867 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1155851832 18:30783605-30783627 GGGAGGCCTCATAATCCTGGTGG - Intergenic
1155880420 18:31141051-31141073 GGGAGGCCTCAGAATCATGGAGG - Intronic
1156650987 18:39227171-39227193 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1156809215 18:41225938-41225960 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1156875099 18:42000679-42000701 GGGAGGCCTCACAATCATGATGG + Intronic
1156941131 18:42767914-42767936 GGGAGGCTTCAAAATCATGGTGG - Intronic
1157045695 18:44099787-44099809 GGGAGGCTTCACAATCATGGTGG - Intergenic
1157530900 18:48419499-48419521 GGGAGGCCTCACAATCATGAGGG - Intergenic
1158221934 18:55159394-55159416 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1158374318 18:56846506-56846528 GGGAGGCCTCAGAATCATGGAGG - Intronic
1159306048 18:66643708-66643730 GGGAGGCCTCAGAATCATGACGG + Intergenic
1159491462 18:69140375-69140397 GGGAGGCTTCAGAATCGTGGCGG + Intergenic
1159585087 18:70276468-70276490 GGGAGACTTCAAAATCCTAAAGG - Intergenic
1159705085 18:71676537-71676559 AGGAGGCCTCAGAATCATGATGG + Intergenic
1160017967 18:75158617-75158639 GGAAGTCTTCAGAGGCCTCATGG - Intergenic
1160629005 18:80232446-80232468 GGGAGGCCTCAGAATCATGGTGG + Intronic
1161514785 19:4690326-4690348 GGGAGGCCTCAGAGCCCCGAGGG + Intronic
1161737513 19:6000684-6000706 GGGAGGCCTCACAAGCATGGCGG - Intronic
1162596367 19:11632658-11632680 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1162596656 19:11634571-11634593 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1163045800 19:14640896-14640918 GGGAGGCCTCAGAATCATGGCGG - Intronic
1163372137 19:16907176-16907198 GGGATGCCTCAGAAGCCAGTGGG - Intronic
1164032457 19:21419770-21419792 GGGAGACTTCAGATGTCTGAGGG + Intronic
1164210243 19:23092189-23092211 GGGAGGCATCAGAATCATGGTGG - Intronic
1164699337 19:30272059-30272081 GGGATCCTTCAGAAGCCTTCTGG - Intronic
1164841313 19:31394511-31394533 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1165076668 19:33283267-33283289 TGGTGGCTTCAGAGGCCTCAGGG + Intergenic
1165408944 19:35646709-35646731 GAGAGGCTTTAGAGGCCAGATGG + Intergenic
1166301513 19:41914176-41914198 GGGAGGCTCCAGGAGGCAGATGG - Intronic
1167403348 19:49287658-49287680 GGGAGGCCTCAGAATCCTGGCGG - Intergenic
1168451790 19:56472063-56472085 GGGAGGCCTCACAATCGTGATGG - Exonic
1202707461 1_KI270713v1_random:34012-34034 GGGAGGCCTCAGAATCATGGCGG + Intergenic
925089778 2:1144599-1144621 GGGAGGCCTCAGAATCATGGTGG + Intronic
925256951 2:2498609-2498631 GGGAGGCCTCAGAATCATGGTGG + Intergenic
925336023 2:3099866-3099888 ATGAGGCTTCAGCAGCTTGAAGG - Intergenic
925805752 2:7646081-7646103 GGGAGGCCTCAGAATCGTGGTGG + Intergenic
926119792 2:10235710-10235732 GGCAGGCGTCAGAAGCCACAAGG - Intergenic
926304154 2:11625891-11625913 GGGAGGCTTCACAATCGTGGTGG + Intronic
926332790 2:11838793-11838815 GGGAGAGATCAGAAGCCTGCTGG - Intergenic
926335572 2:11860114-11860136 GGGTGGCTTCAGAATCATGGCGG + Intergenic
926351307 2:11997417-11997439 GGGAAGCCTCAGAATCATGATGG - Intergenic
926467851 2:13214134-13214156 GGGAGGCCTCACAATCATGATGG + Intergenic
926686597 2:15703111-15703133 GGGAGGCCTCAGAATCATGGCGG + Intronic
926739264 2:16097539-16097561 GGGAGGCCTCACAATCATGATGG + Intergenic
926840299 2:17072179-17072201 GGGAGGCCTCACAATCATGATGG - Intergenic
926944287 2:18170158-18170180 GGGAGGCCTCAGAATCATGGTGG - Intronic
927100197 2:19782176-19782198 GGGAGGCCTCAGAATCATGGCGG - Intergenic
927185385 2:20478577-20478599 GGGAGGCCTCAGAATCATGGTGG - Intergenic
927288116 2:21378211-21378233 GGGAGGCCTCAGAATCATGGTGG + Intergenic
927288403 2:21380194-21380216 GGGAGGCCTCAGAATCATGGTGG + Intergenic
927321171 2:21747328-21747350 TGGAGGCTTGAGAAGTGTGAGGG - Intergenic
927341095 2:21983686-21983708 GGGAGGCCTCAGAATCATGGTGG + Intergenic
927486429 2:23491465-23491487 GTGTGGCTTCAGATGCCTGGGGG + Intronic
928107498 2:28480459-28480481 GGGAGGCTTCACAATCGTGGTGG + Intronic
928171146 2:29003647-29003669 GGGAGTCCTCACAGGCCTGAGGG + Exonic
928465452 2:31518744-31518766 GGGAGGCCTCAGAATCATGGTGG - Intergenic
928777243 2:34780549-34780571 GGGAGGCCTCAGAATCATGGTGG + Intergenic
929047743 2:37806409-37806431 GGGAGGCCTCACAATCATGATGG - Intergenic
929337803 2:40771904-40771926 GGGAGGCCTCACAATCATGATGG - Intergenic
929606735 2:43239770-43239792 GGGATTTTTCAGATGCCTGAAGG - Intronic
929851213 2:45592155-45592177 GGGAGGCCTCAGAATCATGGTGG - Intronic
929868291 2:45736843-45736865 CAGAGGCTTCAGAAGTCTGATGG + Intronic
930006652 2:46903240-46903262 GGGAGGCCTCAGAATCATGGTGG - Exonic
930006935 2:46905107-46905129 GGGAGGCCTCAGAATCATGGCGG - Exonic
930444442 2:51452114-51452136 GGGAGGCCTCAGAATCATGGCGG - Intergenic
930503554 2:52254764-52254786 GGGAGGCCTCAGAATCATGGTGG + Intergenic
930503839 2:52256710-52256732 GGGAGGCCTCAGAAACATGGTGG + Intergenic
931202809 2:60116584-60116606 GGGAGGCTTCAGAATCATGGCGG + Intergenic
931294242 2:60906015-60906037 GGGAGGCCTCAGAATCATGGCGG + Intronic
931789743 2:65654269-65654291 GGGGGCCTTCAGGAGGCTGAAGG + Intergenic
932317861 2:70798092-70798114 GGGAGGCCTCAGAATCATGGTGG + Intergenic
932318135 2:70800015-70800037 GGGAGGCCTCAGAATCATGGTGG + Intergenic
932976299 2:76603361-76603383 GGGAGGCCTCAGAATCATGGTGG + Intergenic
933005209 2:76983535-76983557 GGGAGGCCTCACAATCATGATGG - Intronic
933064926 2:77780851-77780873 GGGAGGCCTCAGAATCATGGTGG - Intergenic
933065159 2:77782729-77782751 GGGAGGCCTCAGAATCATGGGGG - Intergenic
933350236 2:81144894-81144916 GGGAGGCCTCAGAATCATGGTGG + Intergenic
933402031 2:81810353-81810375 GGGAGGCCTCAGAATCATGGTGG - Intergenic
933808683 2:86018399-86018421 GGAAGGCTACAGAAGCCTGGAGG - Intergenic
934127639 2:88913990-88914012 TGGAGGATGCAGAAGACTGACGG + Intergenic
934176250 2:89582354-89582376 GTGAGGCTGCAGCACCCTGAAGG - Intergenic
934286560 2:91656715-91656737 GTGAGGCTGCAGCACCCTGAAGG - Intergenic
935151194 2:100438001-100438023 GAGAGGCTTCAGAATCATGGAGG - Intergenic
935385063 2:102491432-102491454 GGGAGGCTTCACAATCATGGTGG + Intronic
935481581 2:103595816-103595838 GGGAGGCCTCACAATCGTGATGG - Intergenic
935608471 2:104995282-104995304 GGGAGGCCTCAGAATCATGGTGG + Intergenic
935728487 2:106045053-106045075 GGGAGGCTGCATTTGCCTGAGGG + Intergenic
935738961 2:106129743-106129765 GGGAGGCTGGAGATGCCAGATGG + Exonic
935927654 2:108088161-108088183 GGGAGGCCTCAGAATCATGGTGG - Intergenic
935949118 2:108312824-108312846 GGGAGGATTCACAAGCATGGTGG - Intergenic
936080563 2:109429880-109429902 GGGAGCCTGCAGTAGCCTGGAGG + Intronic
936727298 2:115335038-115335060 GGGAGGCTTCACAATCATGGTGG + Intronic
936797387 2:116224009-116224031 GGGTGGCTACACAAGCCTGGAGG - Intergenic
936827681 2:116602051-116602073 GGGAGGCCTCAGAATCATGGTGG - Intergenic
937061973 2:118987545-118987567 GGGAGGATTCAGATGCGAGAGGG + Intronic
937261106 2:120587276-120587298 GCGAGGCTTCAGGCGCCTGGAGG + Intergenic
937349913 2:121154245-121154267 CTGAGGCTTCACAAGGCTGAGGG - Intergenic
937518872 2:122686573-122686595 GGGAGGCCTCAGAATCATGGTGG + Intergenic
937881115 2:126865609-126865631 GGGAGGCCTCAGAATCATGGCGG + Intergenic
937939724 2:127275609-127275631 GTGAGGCTCCAGAAGACTGGAGG + Intronic
938064796 2:128275880-128275902 GGGAGGCTGCAGCAGCCTTCTGG + Intronic
938687737 2:133756823-133756845 GGGAGGCCTCAGAATCATGGTGG + Intergenic
939079061 2:137638416-137638438 GGGAGGCCTCAGAATCATGGTGG - Intronic
939079342 2:137640312-137640334 GGGAGGCCTCAGAACCATGATGG - Intronic
939348743 2:141003645-141003667 AGGAGGCCTCACAAGCATGATGG - Intronic
939694795 2:145311291-145311313 GGGAGGCCTCATAATCATGATGG + Intergenic
939985514 2:148826077-148826099 GGGAGGCCTCACAATCATGATGG - Intergenic
940161155 2:150714993-150715015 GGGAGGCCTCACAATCATGATGG + Intergenic
940616179 2:156051377-156051399 GGGAGGCCTCAGAATCATGGTGG + Intergenic
940691152 2:156922782-156922804 GGGAGGCCTCACAATCATGATGG - Intergenic
940785718 2:157979428-157979450 GGGAGGCTTCACAATCATCATGG - Intronic
941076185 2:161008961-161008983 GGGAGGCATCAGAATCATGGCGG - Intergenic
941459166 2:165746840-165746862 GGGAGGCTTCACAATCATGGCGG - Intergenic
941560163 2:167035058-167035080 GGGAGGCCTCAGAATCATGGTGG - Intronic
941560444 2:167036970-167036992 GGGAGGCCTCAGAATCATGGCGG - Intronic
941742043 2:169045225-169045247 GGGAGGCCTCAGAATCATGGCGG - Intergenic
942204320 2:173604426-173604448 GGGAGGCCTCACAATCCTGGCGG + Intergenic
942234476 2:173890564-173890586 GGGAGGCCTCACAAGCTTGGTGG - Intergenic
942805601 2:179928699-179928721 GGGAGGCCTCAGAATCATGTTGG + Intergenic
942949962 2:181711304-181711326 GGGAGGCCTCAGAATCATGGTGG - Intergenic
943072330 2:183154900-183154922 GGGAGGCCTCAGAATCATGGCGG + Intronic
943081190 2:183260884-183260906 GGAAGGCTTCCGGAGCTTGAAGG + Intergenic
943091838 2:183385020-183385042 GAGAGGGTTCAGATGACTGAGGG - Intergenic
943162518 2:184272174-184272196 GGGAGGAGGCAGAAACCTGATGG + Intergenic
943256210 2:185596442-185596464 GGGAGGCCTCACAATCCTGGTGG - Intergenic
943393160 2:187296291-187296313 GGGAGGCCTCACAATCATGATGG + Intergenic
943438116 2:187892495-187892517 GGGAGGCTTCACAATCATGGTGG - Intergenic
943559866 2:189448090-189448112 GGGAGGCTTCACAATCATGGTGG - Intronic
943978038 2:194509023-194509045 GGGAGGCCTCAGAATCATGGTGG + Intergenic
944010006 2:194964175-194964197 GGGAGGCTTCACAATCATGGTGG + Intergenic
944106253 2:196082751-196082773 GGGAGGCCTCAGAATCATGGTGG - Intergenic
944477620 2:200123997-200124019 GGGAGGCCTCAGAATCATGGTGG + Intergenic
944828128 2:203505270-203505292 GGGAGGCCTCAGAATCATGGTGG + Intronic
945026497 2:205624605-205624627 GGGAGGCCTCAGAATCATGCCGG + Intergenic
945114216 2:206394823-206394845 GGGAGGCCTCACAATCATGATGG - Intergenic
945347337 2:208733497-208733519 GGGAGGCCTCACAATCATGACGG + Intronic
945359990 2:208885750-208885772 GGGAGGCCTCACAATCCTGGTGG - Intergenic
945480186 2:210336381-210336403 GGGAGGCCTCAGAATCATGGCGG - Intergenic
945528013 2:210912875-210912897 GGGAGGCCTCAGAATCATGATGG - Intergenic
945589388 2:211710825-211710847 GGGAGGCCTCACAATCATGATGG - Intronic
945974991 2:216263611-216263633 CTGAGGCTTCTGAAGCATGAAGG + Intronic
946017223 2:216613768-216613790 GGGAGGCCTCAGAATCATGGCGG + Intergenic
946700408 2:222406967-222406989 GGGAGGCTTCATAATCATGGTGG - Intergenic
946757893 2:222965235-222965257 GGGAGGCCTCACAATCATGATGG + Intergenic
946832311 2:223739315-223739337 GGGAGGCCTCAGAATCATGGCGG + Intergenic
947154929 2:227152998-227153020 GGGAGGCCTCACAATCATGATGG + Intronic
947243943 2:228026140-228026162 GGGAGGCCTCACAATCATGATGG - Intronic
947934018 2:233987917-233987939 GGGAGGCCTCACAATCATGATGG - Intronic
948119263 2:235516747-235516769 GGGAAGATTCTGAAGCCTGCCGG - Intronic
948203167 2:236144278-236144300 GGGAGGCTTCACTATGCTGATGG - Intergenic
948296496 2:236864522-236864544 GGGAGGCCTCAGAATCATGGTGG + Intergenic
948346684 2:237304570-237304592 GGGAGGCCTCAGAATCATGGTGG - Intergenic
948448367 2:238051587-238051609 GGGAGGCTTCACAATCATGGTGG - Intronic
948476707 2:238225303-238225325 GGGAGGCATCAGGAGCCGCAGGG + Exonic
948551278 2:238774543-238774565 GGGAGGCCTCAGAATCATGGTGG + Intergenic
948730928 2:239963310-239963332 GGGAGGCGTCAGGAGAGTGAGGG + Intronic
948785864 2:240352607-240352629 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1169075852 20:2759437-2759459 GGGAGGCGAGAGAAGCCTGTGGG - Exonic
1169488871 20:6054937-6054959 GGGAGCCCTCAGAATCATGACGG - Intergenic
1169766295 20:9151594-9151616 GGGAGGCCTCAGAATCATGGCGG - Intronic
1169766568 20:9153523-9153545 GGGAGGCCTCAGAATCATGGCGG - Intronic
1169984696 20:11430776-11430798 GGGAGGCTACAGAAGGTTGATGG + Intergenic
1169999090 20:11595559-11595581 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1170097099 20:12657758-12657780 GGGAGGCCTCAGAATCGTGGCGG - Intergenic
1170136497 20:13079914-13079936 ATCAGGCTTGAGAAGCCTGAAGG - Intronic
1170151509 20:13231496-13231518 GGGAGGCCTCAGAGGCGTGTGGG + Intronic
1170684749 20:18559291-18559313 GGGTGGCCTCAGAGGCCTGGAGG - Intronic
1170784594 20:19456494-19456516 GGGAAGCTTCACAATCCTGGTGG - Intronic
1172143795 20:32742848-32742870 GGGAGGCCGAGGAAGCCTGAGGG - Intronic
1173023692 20:39288385-39288407 AGGAGGCTTCAGAATCATGGTGG - Intergenic
1173227477 20:41170311-41170333 TGGAGGCCTCAGCTGCCTGACGG - Intronic
1173491484 20:43486358-43486380 GGGAGGCTTCACAATCATGGTGG + Intergenic
1173682147 20:44891206-44891228 GGGAGGCTGAGGCAGCCTGAAGG - Intronic
1174116529 20:48230234-48230256 GGGAAGCTTCAGTAGAGTGAGGG - Intergenic
1174123229 20:48283132-48283154 GTGTGGCTTCAGAAGCATGGGGG + Intergenic
1174572541 20:51512344-51512366 GGGAGGCCTGAGAGGCCAGATGG - Intronic
1174718336 20:52784373-52784395 GGGAGGCCTCACAATCATGATGG + Intergenic
1174835526 20:53853144-53853166 GGGAGGATTCAGTTCCCTGAGGG + Intergenic
1174856964 20:54055358-54055380 GGGAGGCCTCAGAATCATGGCGG + Intronic
1175008356 20:55709895-55709917 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1175060363 20:56236583-56236605 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1175195212 20:57238746-57238768 GGGAGGCCTCAGAATCATGGCGG + Intronic
1176933832 21:14843734-14843756 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1177118275 21:17111032-17111054 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1177126931 21:17206027-17206049 GGGAGGCTTCAAAATCATGGTGG + Intergenic
1177139578 21:17343783-17343805 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1177145957 21:17407127-17407149 GGGAGGCCTCACAATCATGATGG - Intergenic
1177199883 21:17942456-17942478 GGGAGGCCTCACAATCCTGGTGG - Intronic
1177393056 21:20501339-20501361 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1177477793 21:21645778-21645800 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1177502483 21:21975952-21975974 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1177523880 21:22267721-22267743 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1177619217 21:23565105-23565127 GGGAGGCTTCACAATCATGGTGG - Intergenic
1177742305 21:25168789-25168811 GGGAGGCCTCACAATCATGATGG - Intergenic
1177821074 21:26031504-26031526 GGGAGGCCTCAGAATCATGGCGG + Intronic
1177945945 21:27469950-27469972 GGGAGGCCTCACAATCATGATGG - Intergenic
1177981201 21:27916456-27916478 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1178099439 21:29252237-29252259 GGGAGGCCTCAGAATCATGGAGG + Intronic
1178104298 21:29300416-29300438 AGGTTGCTTCAGAAGGCTGAAGG + Intronic
1178157549 21:29872659-29872681 GGGAGGCCTCACAATCATGATGG + Intronic
1178301595 21:31458037-31458059 GGGAGGCTACTGAGGCCTGAAGG + Intronic
1178468867 21:32874214-32874236 GGGAGGCCTCAGAATCATGACGG + Intergenic
1178469151 21:32876150-32876172 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1178503784 21:33146902-33146924 GGGAAGCTTCAGAAAACTGCTGG + Intergenic
1178745945 21:35250472-35250494 GGGAGGCCTCACAATCGTGATGG - Intronic
1178793537 21:35722344-35722366 GGGAGGCCTCACAATCATGATGG + Intronic
1178806264 21:35842098-35842120 GGGAGGCCTCACAAGCATGGTGG - Intronic
1179065277 21:38018754-38018776 GGGAGGCCTCACAATCATGATGG - Intronic
1179101789 21:38360815-38360837 GGGAGGCTTCACAATTATGATGG - Intergenic
1179214756 21:39357910-39357932 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1179235435 21:39541358-39541380 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1179439820 21:41385522-41385544 GGGAGGCCTCAGAAGCATGATGG - Intronic
1179801021 21:43811513-43811535 GGGAGGCTCCAGAAGAGGGATGG - Intergenic
1180102195 21:45593671-45593693 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1180749353 22:18113629-18113651 GGGAGACTGCAGAAGGCTGCAGG - Intronic
1181051342 22:20239566-20239588 GGGAGGGTGCAGAGCCCTGAGGG + Intergenic
1181424494 22:22824573-22824595 GGGAGGCTTCCACAGCCAGAGGG - Intronic
1181424499 22:22824593-22824615 GGGAGGCTTCCACAGCCAGAGGG - Intronic
1182520146 22:30880532-30880554 GGGAGGCACCAGAGGCCTGCTGG - Intronic
1182949761 22:34362522-34362544 GGGGGACTTCAGAAGTCAGAGGG - Intergenic
1183213840 22:36466719-36466741 GGGAGGCCTCAGAAGGGTCAAGG + Intergenic
1183641365 22:39094926-39094948 GGGAGGCCTCAGAAGGCAGAAGG - Intergenic
1184098695 22:42330163-42330185 TGGAGGCTGCAGAGGCCTGGAGG + Intronic
1184483450 22:44761805-44761827 GGGAGGCTTCACAATCATGGTGG + Intronic
1185240359 22:49739636-49739658 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1203295856 22_KI270736v1_random:42588-42610 GGGAGGCCTCACAATCATGATGG - Intergenic
949749132 3:7330691-7330713 GGGAGGCCTCAGAATCATGGTGG - Intronic
949939615 3:9144690-9144712 GGGAGGCCTCAGAATCATGGTGG - Intronic
950244860 3:11406664-11406686 GGGAGGCCTCACAATCCTGGTGG + Intronic
950569156 3:13789324-13789346 GGGAGGATGAAGAAGCCTGAAGG - Intergenic
950700532 3:14742743-14742765 GGGAGGCCTCAGAATCATGGTGG + Intronic
950893615 3:16427767-16427789 GGCAGGCATGAGAAGCCTGGAGG - Intronic
951192672 3:19787692-19787714 GGGAGGCCTCAGAATCATGGTGG - Intergenic
951306564 3:21070431-21070453 GGGAGGCCTCACAAGCATGGTGG + Intergenic
951359070 3:21703174-21703196 GGGAGGCCTCAGAATCATGGCGG + Intronic
951932300 3:27981959-27981981 GGGAGGCCTCAGAACCATGGCGG - Intergenic
952029622 3:29125612-29125634 GGGAGGCCTCAGAATCTTGGCGG - Intergenic
952044627 3:29303855-29303877 GGGAGGCCTCAGAATCATGGTGG + Intronic
952490933 3:33871875-33871897 GGGAGGCTGATGAAGGCTGAAGG - Intergenic
952530231 3:34255579-34255601 GGGAGGTTGTAGAAGGCTGAGGG + Intergenic
952589507 3:34933277-34933299 GGGAGGCCTCATAATCATGATGG - Intergenic
952706342 3:36381078-36381100 AGGTGGCTTCTGAAGGCTGAGGG + Intronic
953685661 3:45076596-45076618 GGGAGGCCTCAGAATCATGGTGG - Intergenic
953685944 3:45078534-45078556 GGGAGGCCTCAGAATCATGGTGG - Intergenic
953826764 3:46259989-46260011 GGGAGGCCTCACAATCATGAGGG + Intronic
953827679 3:46268101-46268123 GGGAGGCCTCAGAACCATGCAGG + Intergenic
954109573 3:48426590-48426612 GGGAGGGTCCAGCAGCCTGGTGG + Intronic
954176869 3:48851704-48851726 AGGAGGCCCCAGAACCCTGAGGG + Intergenic
954732497 3:52676498-52676520 GGGAGGCCTCAGAATCATGGTGG - Intronic
954759418 3:52863271-52863293 GGGAGGCCTCAGAATCATGGCGG + Intronic
954759734 3:52865476-52865498 GGGAGGCCTCAGAATCATGGTGG + Intronic
955502105 3:59595718-59595740 GGGAGGCTTCACAATCATGGTGG - Intergenic
955614836 3:60795981-60796003 GGGAGGCCTCAGAATCATGGCGG + Intronic
956350259 3:68327160-68327182 GGGAGGCCTCACAATCATGATGG - Intronic
956412252 3:68991837-68991859 GGGAGGCCTCAGAACCATGGCGG + Intronic
956546220 3:70406980-70407002 GGGAGGCCTCAGAATCATGGTGG + Intergenic
956684324 3:71810243-71810265 GGGATGCATAAGATGCCTGAAGG + Intergenic
956919267 3:73909138-73909160 GGGAGGCCTCACAATCCTGGTGG - Intergenic
956936274 3:74105406-74105428 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957125087 3:76148577-76148599 GGGAGGCTCCAGAAGGTTGGTGG - Intronic
957274550 3:78074120-78074142 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957332692 3:78786745-78786767 GGGAGGCCTCACAACCCTGGTGG - Intronic
957385239 3:79487702-79487724 GAAAAGCTTCAGAAGCCTGTAGG - Intronic
957630363 3:82710265-82710287 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957630652 3:82712183-82712205 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957662479 3:83178469-83178491 GGGAGGCCTCAGAATCATGGCGG + Intergenic
957981876 3:87520596-87520618 GGGAGGCCTCAGAATCATGGTGG - Intergenic
958481761 3:94652804-94652826 GGGAGGCCTCAGAATCATGGTGG - Intergenic
958661313 3:97071460-97071482 GGGAGGCCTCAGAATCATGGCGG + Intronic
958684605 3:97377331-97377353 GGGAGGCCTCAGAATCATGGTGG - Intronic
958684868 3:97379217-97379239 GGGAGTCCTCAGAATCATGATGG - Intronic
958823606 3:99003718-99003740 GGGAGGCCTCACAATCATGATGG + Intergenic
958910970 3:99994718-99994740 GGGAGGCCTCAGAATCATGGTGG + Intronic
959130239 3:102346166-102346188 GGGAGGCTTCATAATCGTGGTGG + Intronic
959172161 3:102856095-102856117 GGGAGGCCTCAGAATCATGGTGG + Intergenic
959203053 3:103272522-103272544 GGGAGGCCTCACAATCATGACGG + Intergenic
959235782 3:103719657-103719679 TGGAGGCCTCAGAATCATGACGG + Intergenic
959367268 3:105477057-105477079 GGGAGGCCTCAGAATCATGGTGG - Intronic
959727238 3:109558274-109558296 GGGAGGCCTCAGAATCATGGCGG - Intergenic
959756370 3:109904924-109904946 GGGAGGCCTCAGAATCATGGTGG + Intergenic
959757519 3:109916463-109916485 GGGAGGCTTCAGAATCATGGTGG - Intergenic
959951295 3:112183746-112183768 GGGAGGATGCAGGAGGCTGAAGG - Intronic
959975099 3:112450052-112450074 GGGAGGCCTCAGAATCATGGCGG + Intergenic
960058421 3:113293903-113293925 GTACTGCTTCAGAAGCCTGAGGG - Intronic
960255246 3:115504905-115504927 GGGAGGCCTCAGAATCATGGCGG - Intergenic
960354313 3:116632399-116632421 GGGAGGCTTCACAATCATGGTGG + Intronic
960496605 3:118383150-118383172 GGGAGGCCTCAGAATCATGGTGG - Intergenic
960529360 3:118745860-118745882 GGGAGGCCTCACAATCATGATGG + Intergenic
960532069 3:118776250-118776272 GGGAGGCTTCACAATCATGGTGG - Intergenic
960841263 3:121962158-121962180 GGGAGGCCTCAGAATCATGGAGG - Intergenic
960943091 3:122947201-122947223 AGGAGCCATCAGAAGTCTGAGGG + Intronic
961067926 3:123891935-123891957 GGGAGGCCTCACAATCATGATGG + Intergenic
961410771 3:126718779-126718801 GGGAGGCCTCCGGAGCCAGACGG - Intronic
961864737 3:129945453-129945475 AGGAGGCTGCCGAGGCCTGAAGG + Intergenic
961962127 3:130865743-130865765 GGGAGGCCTCAGAAACATGGCGG - Intronic
962033674 3:131628309-131628331 GGGAGGCCTCAGAATCATGGTGG + Intronic
962045922 3:131758906-131758928 GGGAGGCCTCAGAATCATGGTGG - Intronic
962098211 3:132314375-132314397 GGGAGGCCTCACAATCATGATGG - Intergenic
962170637 3:133098165-133098187 GGGAGGCCTCAGAAACATGGTGG + Intronic
962311530 3:134330327-134330349 GGGAGGCCTCAAAAGCCTTCCGG + Intergenic
962351205 3:134657123-134657145 GGGAGCCCTCAGAATCATGATGG + Intronic
962366777 3:134792040-134792062 GGGAGGCCTCACAATCATGACGG + Intronic
962368824 3:134804208-134804230 GGGAGGCCTCAGAATCATGGTGG + Intronic
962373637 3:134841474-134841496 GGGAGGCTTCACAAGGATGGAGG + Intronic
962609801 3:137065501-137065523 GGGAGGCTTCACCAGCCTTAGGG + Intergenic
962672728 3:137725844-137725866 GGGAGGCCTCAGAATCATGGCGG + Intergenic
962769824 3:138601957-138601979 GGGAGGCCTCAGAATCATGGGGG - Intergenic
963356403 3:144213476-144213498 GGGAGGCCTCAGAATCATGGTGG + Intergenic
963374717 3:144449549-144449571 GGGAGGCCTCAGAATCATGGCGG - Intergenic
963683730 3:148411789-148411811 GGGAGGCCTCACAATCATGATGG + Intergenic
963834078 3:150038645-150038667 GGGAGGCCTCATAATCATGATGG - Intronic
964076821 3:152701747-152701769 GGGAGGCCTCAGAATGATGAGGG + Intergenic
964098732 3:152963639-152963661 GGGAGGCCTCAGAATCATGGTGG + Intergenic
964426604 3:156560845-156560867 GGGAGGCCTCAGAATCATGGCGG - Intergenic
964427265 3:156567317-156567339 GGGAGGCCTCAGAATCATGGTGG - Intergenic
964427914 3:156572743-156572765 GGGAGGCCTCACAATCATGATGG + Intergenic
964508691 3:157426069-157426091 GGGAGGCCTCAGAATCATGGCGG - Intronic
964520538 3:157562500-157562522 GGGAGGCCTCAGAATCATGGTGG + Intronic
964654433 3:159051175-159051197 GGGAGGCCTCAGAATCGTGGCGG - Intronic
965277845 3:166710018-166710040 GGGAGGCCTCATAATCATGATGG + Intergenic
965458322 3:168930896-168930918 GGGAGGCCTCAGAATCATGGTGG + Intergenic
965904931 3:173692665-173692687 AGAAGGCTACAGAACCCTGAAGG + Intronic
966123250 3:176547062-176547084 GGGAGGCCTCAGAATCATGGTGG + Intergenic
966123515 3:176548977-176548999 GGGAGGCCTCAGAATCATGGTGG + Intergenic
966411531 3:179650760-179650782 GGGAGGCTTCACAATCATGGTGG + Intergenic
966733195 3:183167774-183167796 GGGAGGCCTCAGAATCATGGTGG + Intergenic
966797059 3:183725501-183725523 GGGAGGCCTCACAATCCTGGCGG + Intronic
966838809 3:184071273-184071295 GGGAGGCCTCAGAATCATGGTGG + Intergenic
967345845 3:188454650-188454672 GGGAGGCTTCAGAATCATGGTGG + Intronic
967689418 3:192457121-192457143 GGGAGGCCTCAGAATCATGGTGG - Intronic
967689691 3:192459045-192459067 GGGAGGCCTCAGAATCATGGTGG - Intronic
968763925 4:2458465-2458487 GGGTGGCTTCAGATGCAGGAAGG + Intronic
968767031 4:2477693-2477715 GGGAGGCTTCACAATCATGGCGG - Intronic
969066637 4:4487632-4487654 GGGAGGCGACAGAAGGCTGCAGG - Intronic
969072464 4:4550525-4550547 GGGAGGCCTCAGAATCATGGCGG - Intergenic
969072728 4:4552431-4552453 GGGAGGCCTCAGAATCATGGCGG - Intergenic
969144026 4:5104329-5104351 GGGAGGCTTCACAATCATGGTGG - Intronic
969535473 4:7754122-7754144 GGGAGGCCTCAGAATCATGGCGG - Intergenic
970046432 4:11859675-11859697 GGGAGGCTTCACAACCATGGTGG - Intergenic
970218183 4:13780708-13780730 GGGAGGCCTCAGAATCATGATGG + Intergenic
970222398 4:13824446-13824468 GGGAGGACTCAGAATCATGATGG - Intergenic
970305962 4:14733141-14733163 GGGAGGCCTCAGAATCATGGAGG + Intergenic
970361405 4:15311855-15311877 GGGAGGCCTCAGAATCATGGTGG - Intergenic
970569727 4:17367981-17368003 GGGAGGCTTCACAAGCATGGTGG - Intergenic
970581623 4:17478657-17478679 GGGAGGCCTCAGAATCATGGCGG + Intronic
970742214 4:19251583-19251605 GGGAGGCCTCAGAAACATGGTGG - Intergenic
970868282 4:20783431-20783453 GGGAGGCCTCAGAATCATGGTGG + Intronic
970977528 4:22058217-22058239 GGGAGGCCTCACAATCATGATGG - Intergenic
970978914 4:22074400-22074422 GGGAGGCCTCAGAATCATGGTGG - Intergenic
971027150 4:22599778-22599800 GGCAGGCTTAAGTAGCCTAAGGG - Intergenic
971053009 4:22882249-22882271 GGGAGGCCTCATAATCATGATGG - Intergenic
971057996 4:22935248-22935270 GGGAGGCCTCAGAATCATGGTGG + Intergenic
971258439 4:25034357-25034379 GGGAGGCTTCAAAATCATGGTGG + Intergenic
971352510 4:25865818-25865840 AGGAGACTTCAGAGGCCTGGAGG + Intronic
971600323 4:28583167-28583189 GGGAGGCATCAGAATCATGGTGG - Intergenic
971651194 4:29277305-29277327 GGGAGGCTTCACAATCATGGCGG + Intergenic
971743780 4:30552467-30552489 GGGAAGCTTCAGAATCATGGCGG - Intergenic
971750966 4:30647247-30647269 GGGAGGCCTCACAATCATGATGG - Intergenic
971833627 4:31732744-31732766 GGGAGGCCTCAGAATCATGGTGG - Intergenic
971952874 4:33377538-33377560 GGGAGGCCTCACAATCATGATGG - Intergenic
971996154 4:33967283-33967305 GGGAGGCCTCAGAATCATGGCGG - Intergenic
972014330 4:34225206-34225228 GGGAGGCCTCAGAATCATGGTGG - Intergenic
972871200 4:43300877-43300899 GGGAGGCCTCACAATCATGATGG + Intergenic
972957121 4:44406528-44406550 GGGAGGCCTCAGAATCATGGTGG - Intronic
973156674 4:46963537-46963559 GGGAGGCCTCAGAATCATGGTGG - Intronic
973718275 4:53699454-53699476 AGGAGGCCTCAGAATCATGATGG + Intronic
973718558 4:53701384-53701406 GGGAGGCCTCAGAAACATGGCGG + Intronic
973838452 4:54835764-54835786 GGGAGGCCTCAAAATCATGACGG + Intergenic
974012908 4:56623766-56623788 GGGAGGCCTCAGAATCATGGTGG - Intergenic
974013191 4:56625692-56625714 GGGAGGCCTCAGAATCATGGCGG - Intergenic
974104836 4:57458211-57458233 GGGAGGTTTCAGAATACTGGTGG + Intergenic
974484973 4:62493432-62493454 GGGAGGCCTCAAAATCATGACGG - Intergenic
974487709 4:62525916-62525938 AGGAGGCTTCAGAATCATGGTGG - Intergenic
974495136 4:62616177-62616199 GGGAGGCCTCAGAATCATGGTGG + Intergenic
974495219 4:62616865-62616887 GGGAGGCCTCAGAATCATGGTGG - Intergenic
974532732 4:63130921-63130943 AGGAGACTTTAAAAGCCTGAAGG + Intergenic
974753410 4:66171285-66171307 GGGAGGCCTCAGAATCATGGTGG + Intergenic
974963208 4:68729790-68729812 GGGAGGCCTCAGAATCATAACGG + Intergenic
975632136 4:76414776-76414798 GGGAGGTTTCAGAATCATGAAGG - Intronic
975706506 4:77117380-77117402 GGGAGGCCTCAGAATCATGACGG + Intergenic
975878102 4:78868201-78868223 GGGAGGCCTCAGAATCATGGCGG + Intronic
976003481 4:80400588-80400610 GGGAGGCCTCAGAATCATGATGG - Intronic
976016912 4:80566569-80566591 GTGAGGCTTTAGAAAGCTGAAGG - Intronic
976050999 4:81011467-81011489 GGGAGGCTTCACAATCATGGTGG - Intergenic
976286278 4:83374529-83374551 GGGAGGCCTCAGAATCATGGTGG + Intergenic
976335359 4:83879122-83879144 GGGAGGCCTCACAATCATGATGG - Intergenic
976499879 4:85775422-85775444 GGGAGGCCTCACAATCATGACGG + Intronic
976672785 4:87673004-87673026 GGGAGGCATCACAATCATGACGG + Intergenic
976892655 4:90068929-90068951 GGGAGGCTTCACAATCATGGCGG - Intergenic
977122150 4:93115673-93115695 GGGAGGCCTCAGAATCATGGTGG + Intronic
977592346 4:98841213-98841235 GGGAGGCCTCAGAATCATGGCGG - Intergenic
977670267 4:99686498-99686520 GGGAGGCCTCAGAATCATGGTGG - Intergenic
977675715 4:99744641-99744663 GGGAGGCCTCACAATCCTGGTGG + Intergenic
977704199 4:100053029-100053051 GGGAGGCTTCAGAATCATGAAGG + Intergenic
977949637 4:102955301-102955323 GGGAGGCCTCAGAATCATGTCGG - Intronic
978284333 4:107057887-107057909 GGGAGGCCTCAGAATCATGGTGG + Intronic
978929552 4:114294417-114294439 GGGAGGCCTCAGAATCATGGTGG + Intergenic
979207759 4:118061141-118061163 GAGAGGCTGCAGTAGCGTGAGGG - Intronic
979350885 4:119643302-119643324 GGAGGGCTTCAGAAGCAAGAAGG + Intergenic
979447837 4:120835648-120835670 GGGAGGCCTCACAATCATGATGG - Intronic
980025201 4:127757967-127757989 GGGAGGCCTCAGAATCGTGGTGG + Intronic
980083451 4:128368263-128368285 GGGAGGCCTCAGAATCATGGCGG + Intergenic
980202660 4:129676345-129676367 GGGAGGCCTCAGAATCATGGTGG - Intergenic
980273283 4:130615244-130615266 GCGAGGCTTCACAATCATGATGG + Intergenic
980405503 4:132350053-132350075 GGAAGCCTTGGGAAGCCTGAAGG + Intergenic
980459357 4:133086378-133086400 AGAAAGTTTCAGAAGCCTGAAGG + Intergenic
980999432 4:139814468-139814490 GGATGGCTTCCAAAGCCTGAGGG - Intronic
981138969 4:141245299-141245321 GGGAGGCCTCAGAATCATGGCGG - Intergenic
981238180 4:142442865-142442887 GGGAGGCTTCACAATCATGGTGG + Intronic
981642914 4:146966312-146966334 GGGAGGCCTCAGAATCATGGCGG - Intergenic
982089119 4:151865205-151865227 GGGGGGATTGAGCAGCCTGAAGG - Intergenic
982121371 4:152146564-152146586 GGGAAGCTTCAGAATCATGGTGG + Intergenic
982299765 4:153866818-153866840 GGGAGGCTTCACAATCATGGTGG - Intergenic
982482859 4:155933329-155933351 GGGAGGCCTCAGAATCATGGCGG - Intronic
982730927 4:158954368-158954390 GGGAGGCCTCAGAATCATGGTGG - Intronic
983337630 4:166416789-166416811 GGGAGGCCTCAGAATCATGGTGG + Intergenic
983463061 4:168049960-168049982 GAGAGGCCTCAGAATCATGACGG - Intergenic
983647973 4:170011133-170011155 GGGAGGCCTCAGAATCATGGTGG - Intronic
983879976 4:172922181-172922203 GGGAGGCCTCAGAATCATGGCGG - Intronic
984017217 4:174441035-174441057 GGGAGGCCTCAGAATCATGGTGG + Intergenic
984065911 4:175047961-175047983 GGGAGGCCTCAGAATCATGGCGG - Intergenic
984442691 4:179792533-179792555 GGGAGGCTTCACAATCATGGTGG - Intergenic
984467473 4:180119019-180119041 GGGAGGCCTCAGAATCATGGTGG - Intergenic
984774142 4:183466171-183466193 GGGAGGCCTCAGAATCATGGGGG - Intergenic
984871710 4:184331331-184331353 GGGAGGTTTCAGAAGCCCCGAGG - Intergenic
985133135 4:186759055-186759077 GGGAGGCCTCAGAATCATGGCGG + Intergenic
985183845 4:187295478-187295500 GGGAGGCCTCAGAATCATGGCGG + Intergenic
985761588 5:1751872-1751894 GGGAGGTTTCAGCTGCCTGGGGG - Intergenic
985809044 5:2069704-2069726 GGGAGGCCTCAGAATCATGGCGG - Intergenic
985826537 5:2195735-2195757 GGGAGGCTTCAGAATACGAATGG - Intergenic
986105360 5:4654957-4654979 GGGAGGCCTCAGAATCATGGTGG + Intergenic
986114054 5:4751590-4751612 GGGAGGCCTCAGAATCATGGTGG + Intergenic
986806426 5:11312387-11312409 GGGAGGCCTCAGAATCATGGCGG + Intronic
986817408 5:11427935-11427957 GGGAGGCCTCAGAATCATGGGGG + Intronic
986832339 5:11593701-11593723 GGGAGGCCTCACAATCATGATGG - Intronic
987082242 5:14436181-14436203 GGGAGGCGTCACAATCTTGATGG + Intronic
987097772 5:14565466-14565488 GGGAGGCCTCAGAATCATGGAGG + Intergenic
987098059 5:14567393-14567415 GGGAGGCCTCAGAATCATGGTGG + Intergenic
987099614 5:14580912-14580934 GTGTGGCTTCAGTAGCCTGAGGG - Intergenic
987101221 5:14592856-14592878 GGGAGGCTGGAGAAGCCTGAAGG - Intronic
987225241 5:15833056-15833078 GGGAGGCTTCACAATCATGGTGG - Intronic
987333201 5:16874917-16874939 GGGAGGCCTCAGAATCATGGCGG + Intronic
987350790 5:17020111-17020133 GGGAGGCCTCACAATCATGATGG + Intergenic
987391417 5:17379417-17379439 GGGACCATTTAGAAGCCTGAGGG - Intergenic
987461413 5:18216001-18216023 GGGAGGCTTCACAATCATGGTGG + Intergenic
987612099 5:20218764-20218786 GGGAGGCCTCAGAATCATGGCGG - Intronic
987725182 5:21688630-21688652 GGAAGGCTTCAGAATCATGGCGG - Intergenic
987810085 5:22823467-22823489 GGGAGGCCTCACAATCATGATGG - Intronic
987894468 5:23926534-23926556 GGGAGGCCTCAGAATCATGGCGG + Intergenic
987984164 5:25124414-25124436 GGGAGGCCTCAGAATCATGGTGG - Intergenic
988204246 5:28114430-28114452 GGGAGGCCTCAGAATCATGGTGG + Intergenic
988378844 5:30476172-30476194 GGAAGGCTTCAGAAACATGGTGG + Intergenic
988495125 5:31738384-31738406 GGCTGGCTTCAGAAGGCTGCAGG + Intronic
989191047 5:38670084-38670106 GGGAGACTTCTAAATCCTGACGG - Intergenic
989297700 5:39849262-39849284 GGGAGGCTTCACAATCATGGTGG + Intergenic
989504759 5:42215079-42215101 GGGAGACTTCACTATCCTGAAGG - Intergenic
989775896 5:45206655-45206677 GGCAGGCTTAAGACGCCTAAGGG - Intergenic
990051410 5:51506157-51506179 GGGAGGCTTCACAATCATGGTGG + Intergenic
990093547 5:52084173-52084195 GGGAGGCCTCAGAATCATGGTGG + Intergenic
990443253 5:55867723-55867745 GGGAGGCCTCAGAATCATGGTGG + Intronic
990804411 5:59642622-59642644 GGGAGGCCTCAGAATCATGGTGG - Intronic
991104776 5:62831968-62831990 GGGAGGCCTCAGAATCATGGCGG + Intergenic
991183723 5:63784367-63784389 GGGAGGCCTCAGAATCATGGTGG - Intergenic
991619574 5:68531628-68531650 GGGAGGCCTCAGAATCATGGCGG - Intergenic
992742330 5:79786134-79786156 GAGAGGCCTCTGAAGCCTGCTGG + Intronic
992812229 5:80400434-80400456 AGGAGGCTTCAGAATCATGGTGG + Intergenic
993001070 5:82380886-82380908 GGGAGACTTCACAATCATGATGG + Intronic
993083165 5:83328070-83328092 GGGAGGCCTCAGAATCATGGCGG + Intronic
993098093 5:83504872-83504894 GGGAGGCCTCAGAATCGTGGCGG + Intronic
993256144 5:85592300-85592322 GGGAGGCCTCAGAATCATGGCGG + Intergenic
993275598 5:85852801-85852823 GGGAGTTTTCAGAAATCTGATGG - Intergenic
993575293 5:89592142-89592164 GGGAGGCCTCAGAATCATGGTGG - Intergenic
994114483 5:96046781-96046803 GGGAGGCCTCAGAATCATGGTGG + Intergenic
994337881 5:98590417-98590439 GGGAGGCCTCACAATCATGATGG - Intergenic
994637815 5:102364354-102364376 GGAAGGCATCAGAATCATGACGG + Intergenic
994853330 5:105085191-105085213 GGGAGGCTTCACAATCATGGTGG - Intergenic
995312532 5:110730567-110730589 GGGAGGCCTCAGAATCATGGCGG + Intronic
995357703 5:111258447-111258469 GGGAGGCCTCAGAATCATGGTGG + Intronic
995389900 5:111628139-111628161 GGGAGGCTTCAGAATCATAATGG - Intergenic
995737770 5:115320895-115320917 GAGAGGCTTCAGAATTATGATGG + Intergenic
996196212 5:120610676-120610698 GGGAGGCCTCAGAATCATGGTGG - Intronic
996222688 5:120952838-120952860 GGGAGGCATCAGAATCATGGTGG - Intergenic
996222960 5:120954800-120954822 GGGAGGCCTCAGTATCATGAAGG - Intergenic
996237002 5:121142521-121142543 GGGAGGCCTCACAATCATGATGG + Intergenic
996274028 5:121642649-121642671 GGGAGGCCTCACAATCATGATGG + Intergenic
996282733 5:121750977-121750999 GGGAGGCCTCAGAATCATGACGG + Intergenic
996519643 5:124412861-124412883 GGGAGGCCTCAGAATCATGGTGG + Intergenic
996700213 5:126443509-126443531 GGGAGGACTCTGAAGCCTCAGGG - Intronic
996774603 5:127120212-127120234 GGGAGGCCTCACAATCATGATGG + Intergenic
997056794 5:130453082-130453104 GGGAGGCCTCAGAATCATGGTGG + Intergenic
997091982 5:130869066-130869088 GGGAGGCCTCAGAACCATGGTGG + Intergenic
997108368 5:131046878-131046900 GGGAGGCCTCAGAATCATGGGGG + Intergenic
997280187 5:132637910-132637932 GGGAGGATTCAAGAGCCTGGTGG - Intronic
997491738 5:134283391-134283413 GGGAGGCTTCACAATCATGGTGG + Intergenic
997492188 5:134286620-134286642 GGGAGGCTTCACAATCATGGTGG + Intronic
997506420 5:134421214-134421236 GGGAGGCCTCAGAATCATGGCGG + Intergenic
997589421 5:135063787-135063809 GGGAGGCTGCACAAGCCCCACGG - Intronic
997642267 5:135456913-135456935 GTGAGGCTTCTGCAGCCAGACGG + Intergenic
998576784 5:143325227-143325249 GGGAGGCCTCAGAATCATGGCGG + Intronic
998591034 5:143478588-143478610 GGGAGGCCTCACAATCCTGGAGG - Intergenic
999012178 5:148055245-148055267 GGGAGGCTTCACAATCATGGTGG - Intronic
999253986 5:150199376-150199398 GGGAGGCCCCGGAGGCCTGAGGG + Intronic
999804734 5:155071159-155071181 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000226690 5:159267841-159267863 GGGAGGCCTCAGAATCATGGTGG - Intronic
1000564735 5:162833994-162834016 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000565019 5:162835899-162835921 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000570079 5:162901041-162901063 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1000676187 5:164125935-164125957 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000750942 5:165096643-165096665 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1001027142 5:168233775-168233797 GGGAGGCCTCAGAATCATGGCGG + Intronic
1001454603 5:171851073-171851095 GGGAGGCTGCAGACCCCAGAGGG - Intergenic
1001515500 5:172352779-172352801 GGGAGGCCTCAGAATCATGGCGG - Intronic
1001554918 5:172630700-172630722 GGCAGGGTCCTGAAGCCTGAGGG - Intergenic
1002320160 5:178370483-178370505 GAGAGGCTTCAGAAACTTGGCGG + Intronic
1002464231 5:179397784-179397806 GGGAGGCCTCAGAATCATGGGGG - Intergenic
1002693310 5:181066018-181066040 GGGAGGCTTCTGCTGCTTGAGGG + Intergenic
1002892873 6:1352114-1352136 GGGAGGCCTCAGAATCATGATGG + Intergenic
1003299512 6:4864749-4864771 GGGAGGCCTCAGAATCATGGTGG - Intronic
1003346303 6:5271088-5271110 TTGAGGGTTCAGAAGCCAGATGG + Intronic
1003373130 6:5548012-5548034 GGGAGGCCTCAGAATCATGGCGG + Intronic
1003659178 6:8044326-8044348 GGGAGGCCTCAGAATCATGGTGG - Intronic
1004032061 6:11880223-11880245 GGGAGGCCTCACAATCATGACGG + Intergenic
1004351218 6:14892028-14892050 AGGAGGCCTCAGAATCATGACGG - Intergenic
1004379809 6:15122940-15122962 GGGAGGCTTCAGAATCATGGTGG - Intergenic
1004522339 6:16373752-16373774 GGGAGGCTTCACAATCATGGTGG - Intronic
1004592681 6:17069037-17069059 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1004592950 6:17070959-17070981 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1004692470 6:18004137-18004159 GGGAGGCTTCAGTGGGCAGATGG + Intergenic
1005905123 6:30255786-30255808 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1005906541 6:30265974-30265996 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1006240592 6:32674247-32674269 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1006611596 6:35297545-35297567 GGAAGGCTCCAGAAGCCTCCGGG + Intergenic
1006667777 6:35709133-35709155 GGGAGGCCTCACAATCATGATGG + Intronic
1006697306 6:35941733-35941755 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1007250244 6:40490366-40490388 GCGAGGCTGCAGCTGCCTGATGG + Intronic
1007943670 6:45805794-45805816 GGGAGGCTTCACAATCATGGTGG + Intergenic
1008058707 6:46974071-46974093 GGGAGCCTTCCAAAGTCTGATGG - Intergenic
1008297994 6:49801723-49801745 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1008345452 6:50421345-50421367 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1008363743 6:50651111-50651133 GGGAGGCCTCAGAATCATGATGG - Intergenic
1008650255 6:53553889-53553911 GGGAGGCCTCAGAATCATGGTGG - Intronic
1008830142 6:55749079-55749101 GGGAGGCTTCACAATCATGGAGG - Intergenic
1008930321 6:56932291-56932313 GGGAGGCCTCAGAATCATGGCGG - Intronic
1009490359 6:64283751-64283773 GGGAGGCCTCAGAATCATGGTGG + Intronic
1009490632 6:64285711-64285733 GGGAGGCTTCACAATCATAATGG + Intronic
1009897745 6:69774269-69774291 GGGAGGCTTCATAATCATGGTGG - Intronic
1009990414 6:70836231-70836253 GGGAGGCCTCACAATCATGATGG + Intronic
1010060527 6:71617144-71617166 GGGAGGCCTCACAATCATGACGG - Intergenic
1010323948 6:74543940-74543962 AGGAGGCCTCACAAGCCTGTTGG + Intergenic
1010494275 6:76514165-76514187 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1010611739 6:77962131-77962153 GGGAGGCCTCAGAATCATGACGG - Intergenic
1010730625 6:79387011-79387033 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1011122235 6:83965947-83965969 GGGAGGCCTCAGAATCATGGCGG - Exonic
1011148092 6:84240934-84240956 GGGAGGCCTCACAATCATGATGG - Intergenic
1011284403 6:85707648-85707670 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1011343893 6:86347721-86347743 GGGAGGCCTCACAATCATGATGG + Intergenic
1011353749 6:86452688-86452710 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1011355311 6:86467274-86467296 GGGAGGCCTCACAATCATGAAGG - Intergenic
1011372320 6:86650480-86650502 GGGAGGCCTCACAATCATGAAGG - Intergenic
1011943709 6:92874180-92874202 GGGAGGCTTCAGAATCATGGCGG - Intergenic
1012194039 6:96317259-96317281 GGGAGGCCTCACAATCATGATGG + Intergenic
1012365689 6:98436989-98437011 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1012403971 6:98872762-98872784 GCAATGCTTCAGAAGCCAGATGG + Exonic
1012546496 6:100425200-100425222 GGGAGGCCTCAGAATCATGGCGG - Intronic
1012664597 6:101951799-101951821 GGGAGGCTTCACAATCATGGTGG - Intronic
1012826487 6:104152590-104152612 TGGAGGCTTCAGAATCATGGCGG + Intergenic
1012911404 6:105121952-105121974 GTGAGGGTGGAGAAGCCTGATGG + Intronic
1012994408 6:105959300-105959322 GGGTGGTGTCAGAGGCCTGAGGG - Intergenic
1013080910 6:106811815-106811837 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1013177103 6:107687363-107687385 GGGAGGCCTCACAATCATGATGG + Intergenic
1013535717 6:111061483-111061505 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1013558201 6:111278677-111278699 GGGAGGCTTCACAATCATGGCGG - Intergenic
1013935247 6:115586476-115586498 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1014471366 6:121819071-121819093 GGGAGGCCTCAGAATCATGATGG - Intergenic
1014482261 6:121953548-121953570 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1014488778 6:122036076-122036098 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1014576516 6:123081224-123081246 GGAAGGCCTCAGAATCATGATGG + Intergenic
1014730808 6:125030008-125030030 GGGAGGCCTCAGAATCATGGCGG + Intronic
1014731077 6:125031953-125031975 GGGAGGCCTCAGAATCATGGTGG + Intronic
1014742300 6:125160058-125160080 GGGAGGCCTCACAATCATGATGG - Intronic
1014773901 6:125486913-125486935 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1014863090 6:126495660-126495682 GGGAGGCCTCAGAATCATGATGG + Intergenic
1015195545 6:130521530-130521552 GGGAGGCCTCACAACCATGATGG + Intergenic
1015271934 6:131345414-131345436 TGGAGGCTGCAGAAGCCTGCAGG - Intergenic
1015518511 6:134108575-134108597 GGGAGGCCTCACAATCCTGGGGG + Intergenic
1015631630 6:135237349-135237371 GGGGAGCTTCAGAAGGCTCAGGG + Intergenic
1015670855 6:135688266-135688288 GGGAGGCCTCAGAATCATGATGG + Intergenic
1015773493 6:136792084-136792106 GGGATGGTGCAGAAGCCCGAGGG + Exonic
1015990546 6:138937021-138937043 GGGAGGCTTCACAATCATGGTGG + Intronic
1015997338 6:139008223-139008245 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1016202696 6:141431237-141431259 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1016212984 6:141562638-141562660 GGGTGACTTCTGAAGCCTAAGGG - Intergenic
1016297346 6:142587420-142587442 GGGAGGCGTCAGAATCATGGTGG - Intergenic
1016581443 6:145633082-145633104 GGGACTCTGCAGAAGCCTGAGGG - Intronic
1016782931 6:147979760-147979782 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1016794922 6:148107777-148107799 GGGAGGATTCAGAATCAAGAAGG - Intergenic
1016987759 6:149907880-149907902 GGGAGGCTTCACAATCATCATGG - Intergenic
1017289375 6:152717636-152717658 GGGAGGCCTCACAATCCTGGTGG - Intronic
1017387855 6:153907057-153907079 GGGAGGCATCAGAATCATGAAGG - Intergenic
1017532283 6:155307357-155307379 GGGAGGCCTCACAATCATGACGG + Intronic
1017547673 6:155469251-155469273 GGGAGGCTTCAGAATCATGGCGG + Intergenic
1017776366 6:157684139-157684161 GGGTGCCTTGAGAAGCCTGGGGG - Intergenic
1017801263 6:157898342-157898364 TGGAGGCTGCAGAAGGCTGAGGG + Intronic
1017979619 6:159388773-159388795 GGCAGGCTTCAAAATCATGATGG - Intergenic
1018086135 6:160302823-160302845 GGGAGGCCTCACAATCATGATGG + Intergenic
1018872352 6:167792938-167792960 GGGAGGCCTCAGAATCATGGCGG - Intronic
1018943659 6:168329350-168329372 GGGAGGGCTCAGAAGGCTGCAGG - Intergenic
1019093545 6:169560508-169560530 GGGAGGCTGCCCAAGCCTGACGG + Intronic
1019162234 6:170076423-170076445 GGGAGGCTTCAAAACCCAGGAGG - Intergenic
1019264033 7:102300-102322 GGGAGGTGGCAGAAGCCAGATGG + Intergenic
1019595400 7:1856170-1856192 GAGAGGCGTCAGAAGCAGGAGGG - Intronic
1020537989 7:9425254-9425276 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1020631683 7:10648517-10648539 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1020765786 7:12318940-12318962 GGGAGCTTTCAGAAGACTCAAGG + Intergenic
1020781059 7:12517300-12517322 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1021060572 7:16105677-16105699 GGTTGCCTTCAGAAGCCTGATGG + Intronic
1021116410 7:16750589-16750611 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1021507540 7:21402156-21402178 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1021968873 7:25949000-25949022 GGGATGCTTCAGAAACCTGGGGG - Intergenic
1021985015 7:26089751-26089773 GGGAGGCCTCAGAATCGTGGTGG - Intergenic
1022349416 7:29553639-29553661 GGGAGGCCTCACAATCATGATGG + Intergenic
1022605621 7:31811257-31811279 GGGAGGCTTCACAATCATGGTGG - Intronic
1022678262 7:32521051-32521073 GGGAGGCCTCAGAATCATGATGG - Intronic
1022703493 7:32782498-32782520 GGGAGGCCTCACAATCATGATGG + Intergenic
1023236106 7:38089762-38089784 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1023265112 7:38396402-38396424 GGGAGGCCTCACAATCATGATGG - Intronic
1024110029 7:46135193-46135215 GGGAGGCCTCACAATCATGATGG + Intergenic
1024138105 7:46431036-46431058 GGGAGGCCTCAGAATCATGCTGG + Intergenic
1024180981 7:46894618-46894640 GGGAGGCCTCACAACCATGATGG - Intergenic
1024199804 7:47095294-47095316 ATGGGGCCTCAGAAGCCTGAAGG + Intergenic
1024207705 7:47177926-47177948 GGGAGGCCTCACAATCATGAGGG - Intergenic
1024462291 7:49670922-49670944 AGGAGGCTGCAGATTCCTGAAGG - Intergenic
1024543294 7:50496832-50496854 AGGAGGCAGCAGAAGCTTGAGGG + Intronic
1024674926 7:51629860-51629882 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1024733069 7:52274116-52274138 TGGAGGCTGGAGAAGCCTGCGGG - Intergenic
1024771176 7:52725030-52725052 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1024779006 7:52823963-52823985 GGGAGGCCTCACAATCATGATGG - Intergenic
1024995391 7:55270135-55270157 GGGAGGCTTCAGAGGCCTGTTGG - Intergenic
1025062424 7:55821924-55821946 GGGAGGCCTTAGAAGCATGGTGG + Intronic
1025474027 7:60897199-60897221 GGGAAGCTTCAGAAGGCAAAAGG - Intergenic
1025512975 7:61592675-61592697 GGGAAGCTTCAGAAGGCAAAAGG + Intergenic
1026133670 7:67641049-67641071 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1026233997 7:68510080-68510102 GGGAGGTTTCAAATGGCTGAGGG - Intergenic
1026297841 7:69070894-69070916 TGGGGGCTACAGAAGCCCGAGGG - Intergenic
1026571629 7:71536487-71536509 GGGAGGCCTCAGAATCATGGCGG + Intronic
1027516310 7:79146705-79146727 GGGAGGCCTCACAATCATGATGG - Intronic
1027834310 7:83220246-83220268 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1027922731 7:84416340-84416362 GGGAGGCCTCAGAATCATGGCGG - Intronic
1027969100 7:85054664-85054686 GAAAGTGTTCAGAAGCCTGAGGG + Intronic
1028367336 7:90048985-90049007 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1028510316 7:91618151-91618173 GGGGGACTTGAGCAGCCTGATGG - Intergenic
1028631785 7:92942933-92942955 GGGAGGCCTCACAATCATGATGG - Intergenic
1028745435 7:94321437-94321459 GGGAGGCCTCAGAATCGTGGTGG + Intergenic
1028790036 7:94843612-94843634 GGGAGGCCTCACAATCCTGGTGG - Intergenic
1029048968 7:97663412-97663434 GGGAGGCTTCACAATCATGGTGG + Intergenic
1029600432 7:101560072-101560094 GGGAGGCTTCACAATCATGGTGG + Intergenic
1029747076 7:102521949-102521971 GGGAGTCATCAGAGGCCAGATGG + Intergenic
1029765029 7:102621038-102621060 GGGAGTCATCAGAGGCCAGATGG + Intronic
1029796906 7:102906006-102906028 GGGAGGCCTCAGAATCATGGCGG + Intronic
1029859716 7:103556720-103556742 GGGAGGCCTCAGAATCGTGGCGG - Intronic
1030541541 7:110836535-110836557 GGGAGGCCTCACAATCATGATGG - Intronic
1030723264 7:112894542-112894564 GGGAGGCCTCACAATCATGATGG + Intronic
1030786492 7:113669990-113670012 GGGAGGCTTCACAATCATGGTGG - Intergenic
1030805256 7:113910000-113910022 GGGAGGCCTCACAATCATGACGG + Intronic
1030904132 7:115162111-115162133 GGGAGGCCTCACAATCATGATGG + Intergenic
1031012529 7:116538795-116538817 GGGAGGCTTCACAATCATGGAGG + Intronic
1031055749 7:116991397-116991419 GGGAGGCTTCAGAATCATGGGGG + Intronic
1031082065 7:117267968-117267990 GGGAGGCCTCATAAGCATGGTGG + Intergenic
1031145600 7:117994165-117994187 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1031299337 7:120043641-120043663 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1031904072 7:127441560-127441582 GGGAGGCTTCACAATCATGGTGG - Intergenic
1032318151 7:130860259-130860281 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1032362895 7:131272671-131272693 GGGAGGCCTCAGAATCATGGTGG + Intronic
1032633679 7:133682466-133682488 GGGAGGCCTCAGAATCATGGTGG - Intronic
1032875723 7:136036140-136036162 GGGAGGCTTCACAATCATGACGG + Intergenic
1033012898 7:137641200-137641222 GGGAGGCTTCACAATCATGGTGG - Intronic
1033221384 7:139528431-139528453 GGGAGGCTTCACAATCATGAAGG + Intronic
1033456549 7:141508626-141508648 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1033735033 7:144213944-144213966 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1033748023 7:144337025-144337047 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1033865699 7:145687929-145687951 GGGAGGCTTCAGAATCATGGTGG + Intergenic
1033905050 7:146192453-146192475 GGGAGGCCTCATAATCCTGGTGG + Intronic
1033989975 7:147271593-147271615 GGGAGGCCTCACAATCCTGATGG + Intronic
1034012591 7:147546004-147546026 GGGAGGCTTCACAATCATGGCGG - Intronic
1034052097 7:147994671-147994693 GGGAGGCTTCACAATCATGGTGG - Intronic
1034122342 7:148639188-148639210 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1034320361 7:150174250-150174272 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1034772381 7:153792971-153792993 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1034851786 7:154500644-154500666 GGGAGGCCTCACAATCCTGGTGG - Intronic
1034892909 7:154856338-154856360 GGGAGGCTTTAGGAGCCCCAAGG - Intronic
1035237073 7:157504637-157504659 GGGACGCTTCATAATGCTGAAGG - Intergenic
1035348148 7:158221565-158221587 GGGAGGCCTCACAATCATGATGG + Intronic
1035543619 8:461365-461387 GGGAGGCCTCACAATCCTGGTGG + Intronic
1035840844 8:2810677-2810699 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1035859543 8:3013033-3013055 GGGAGGCTTCACAATCATGGTGG - Intronic
1035943031 8:3925719-3925741 GGGAGGCCTCAGAATCATGGCGG - Intronic
1036000472 8:4596990-4597012 GGGAGGCCTCAGAATCATGGCGG - Intronic
1036014713 8:4769651-4769673 GGGAGGCTTGGAAAGGCTGACGG + Intronic
1036414545 8:8535031-8535053 GGGAGGCTTCACAATCATGGTGG + Intergenic
1036457898 8:8925589-8925611 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1036939313 8:13036404-13036426 GGGAGGCCTCACAATCATGACGG + Intergenic
1037048644 8:14341832-14341854 GGGAGGCTTCAGAATCATGGCGG - Intronic
1037117702 8:15246428-15246450 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1037117975 8:15248264-15248286 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1037747346 8:21657017-21657039 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1037838533 8:22228532-22228554 GGGAGGCTGGAGAAGGATGATGG + Intronic
1038139189 8:24823538-24823560 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1038158241 8:25011415-25011437 GGAAGGCTTCATAAAGCTGATGG - Intergenic
1038299114 8:26325390-26325412 GGAAGGCCTCAGAATCATGACGG - Intronic
1038312521 8:26455511-26455533 GGGAGGCTGGAGGAGACTGAGGG - Intronic
1038589239 8:28821266-28821288 GGGAGGCCTCAGAATCATGGTGG + Intronic
1038987312 8:32826324-32826346 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1039389002 8:37162099-37162121 GGGAGGCCTCACAATCATGATGG + Intergenic
1039858677 8:41437897-41437919 GGGAGGCTTCACAATCATGGCGG - Intergenic
1040095043 8:43434764-43434786 GGGAGGCCTAAGAATCATGATGG - Intergenic
1040643664 8:49371757-49371779 GGGAGGCCTCAGAATCATGACGG + Intergenic
1041432304 8:57796398-57796420 GGGAGGCCTTAGAAGACGGAGGG - Intergenic
1041497391 8:58502228-58502250 GGGAGGCCTCACAATCATGATGG - Intergenic
1041756962 8:61324394-61324416 GGGAGGCCTCAGAATCATGGTGG - Intronic
1042080726 8:65047929-65047951 GGGAGGCCTCACAATCATGATGG + Intergenic
1042085235 8:65100130-65100152 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1042468289 8:69153803-69153825 GGGAGGCCTCACAAGCATGGTGG + Intergenic
1043141336 8:76593663-76593685 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1043287918 8:78558439-78558461 GGGAGGCCTCAGAATCATGGTGG + Intronic
1043591251 8:81835776-81835798 GGGAGGCCTCACAATCATGATGG + Intronic
1043788581 8:84433682-84433704 GGGAGGCCTCAGAATCATGGTGG - Intronic
1044538357 8:93382650-93382672 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1044784742 8:95781974-95781996 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1045111699 8:98942693-98942715 GGGAGGCTTGGGGAGTCTGAAGG + Intronic
1045214310 8:100131147-100131169 GGGAGGCCTCAGAATCATGGTGG + Intronic
1045368242 8:101495179-101495201 GAGAGGCTTCATCAGCCTCATGG + Intronic
1045603945 8:103751085-103751107 GGGAGGCCTCACAATCCTGGTGG - Intronic
1045732115 8:105254981-105255003 GGGAGGCCTCAGAATCATGGTGG + Intronic
1045786445 8:105926757-105926779 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1045825681 8:106395382-106395404 GGGAGGCCTCAGAATCATCATGG + Intronic
1045993932 8:108341273-108341295 GGGAGGCCTCAGAATCATAATGG + Intronic
1046092617 8:109521005-109521027 GGGAGGCCTCCCAAGTCTGAGGG - Intronic
1046129141 8:109945789-109945811 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1046703344 8:117425037-117425059 GGGAGGCCTCACAATCATGATGG + Intergenic
1046855613 8:119028430-119028452 GGGAGGCCTCAGAATCATGGTGG + Intronic
1047058338 8:121193242-121193264 GGGAGGCTTCAGAAACATGGTGG + Intergenic
1047195636 8:122718742-122718764 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1047562720 8:126007241-126007263 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1047796461 8:128261050-128261072 TTGAGGCTTCAGAAGCCACATGG + Intergenic
1047823980 8:128553089-128553111 GGGAGGCCTCACAAGCATGCTGG + Intergenic
1047947085 8:129891147-129891169 GGGAGAATTTAGGAGCCTGAAGG - Intronic
1048046240 8:130775838-130775860 GGGAGGCCTCACAATCCTGGTGG - Intergenic
1048239615 8:132728264-132728286 GGGAGGCTTCACAATCATGGTGG + Intronic
1048303149 8:133266011-133266033 GGCAGGTCTCAGCAGCCTGATGG - Intronic
1048460588 8:134618073-134618095 GGGAGGCCTCAGAATCATGGCGG - Intronic
1048642290 8:136377223-136377245 GGGAGGCTTCACAATCATGGTGG + Intergenic
1048655702 8:136533663-136533685 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1048746158 8:137616799-137616821 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1048783127 8:138022861-138022883 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1048802583 8:138207559-138207581 AGGAGCCTTCAGAAAGCTGAAGG - Intronic
1048873125 8:138815121-138815143 GGGAGGCTTCACAATCATGGTGG - Intronic
1048917591 8:139199594-139199616 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1048923496 8:139251225-139251247 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1049289126 8:141792219-141792241 GGAAGGATTCACAGGCCTGATGG + Intergenic
1049577623 8:143397031-143397053 GGGAAGCTCCAGTGGCCTGAGGG + Intergenic
1049626432 8:143624474-143624496 GGGAGGCCTCACAATCATGATGG + Intergenic
1049675958 8:143889196-143889218 GTGTGGCTTCAGAGGGCTGAGGG + Intergenic
1050086696 9:1973224-1973246 GGGAGGCCTCAAAATCATGATGG - Intergenic
1050134103 9:2443244-2443266 GGGAGGCCTCACAATCATGATGG - Intergenic
1050785777 9:9399784-9399806 GGGAGGCTTCAGAATCATGGCGG - Intronic
1051376424 9:16407195-16407217 GGAAAGCTTCATACGCCTGATGG + Intergenic
1051384232 9:16490219-16490241 GGGAGGCCTCAGAATCATGGTGG + Intronic
1051450520 9:17192934-17192956 GGGAGGCCTCAGAATCATGGTGG + Intronic
1051619663 9:19037598-19037620 GGGAGGCCTCAGAATCATGGCGG - Intronic
1051726767 9:20095804-20095826 GGGAGGCCTCACAAGCATGGTGG + Intergenic
1051931927 9:22396218-22396240 GGGAGGCTTCACAATCATGGTGG + Intergenic
1051979379 9:22996284-22996306 GGGAGGCCTCATAAGCATGGTGG + Intergenic
1052019242 9:23507321-23507343 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1052019517 9:23509233-23509255 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1052078930 9:24179596-24179618 GGGAGGCTTCACAATCATGGTGG + Intergenic
1052087819 9:24290154-24290176 GGGAGGCTTCACAATCATGGTGG + Intergenic
1052170603 9:25391401-25391423 GGGAGGCCTCACAATCATGATGG + Intergenic
1052217921 9:25989417-25989439 GGGAGGCCTCACAATCATGAAGG + Intergenic
1052351610 9:27464729-27464751 GGGAGGCCTCAGAATCATGGCGG + Intronic
1052576177 9:30294130-30294152 GAGAGGCCTCAGAATCATGATGG + Intergenic
1052701477 9:31942401-31942423 GGGAGGCTTCACAGTCATGATGG - Intergenic
1052721499 9:32176234-32176256 GGGAGGCTTCACAATCATGGTGG + Intergenic
1055363845 9:75523872-75523894 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1055595456 9:77861089-77861111 GGGAGGCCTCACAATCATGATGG + Intronic
1055595863 9:77863726-77863748 GGGAGGCCTCACAATCATGATGG + Intronic
1055679734 9:78703197-78703219 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1055701210 9:78947780-78947802 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1055888749 9:81099218-81099240 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1056070854 9:82985236-82985258 GGGAGGCCTCAGAATCATGGGGG + Intronic
1056488875 9:87085715-87085737 TGGAGGCTTCAGAAACCTCTGGG - Intergenic
1056659751 9:88535126-88535148 GGGAGGGTGCAGAGACCTGAGGG + Exonic
1056829122 9:89900094-89900116 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1056962037 9:91133909-91133931 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1057202149 9:93146914-93146936 GGGAGGCCTCACAATCATGATGG - Intergenic
1058141052 9:101357265-101357287 GGGAGGCCTCACAATCATGATGG + Intergenic
1058147716 9:101430225-101430247 GGGAGGCTAGAGAGGCCTGAGGG - Intronic
1058226978 9:102377017-102377039 GGGAGGCTTCACAATCATGGTGG + Intergenic
1058376719 9:104330410-104330432 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1058513807 9:105749321-105749343 GGGAGGCTTCACAATCATGGTGG + Intronic
1058725212 9:107796655-107796677 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1058725284 9:107797404-107797426 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1058810172 9:108631384-108631406 GGGAGGCCTCACAATCATGATGG - Intergenic
1059540802 9:115128503-115128525 GGGAGGCCTCACAATCATGATGG + Intergenic
1059582323 9:115565460-115565482 GTGAGGCTTCTGAAGCCACATGG - Intergenic
1059587387 9:115620650-115620672 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1059716510 9:116918104-116918126 GGGAGGCATCAGAATCATGATGG - Intronic
1059903603 9:118956327-118956349 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1059920716 9:119157264-119157286 GGGAGTCCTCAGAATCATGATGG - Intronic
1060310700 9:122458498-122458520 GGGAGGCTTCACAATCGTGGTGG + Intergenic
1062337715 9:136079706-136079728 GCGTGGCTGCAGAAGCCAGATGG + Intronic
1062468333 9:136691311-136691333 GGGAGGCATCAGGAGACAGAAGG + Intergenic
1062616626 9:137399688-137399710 GGGAGGCTTCAGAATCATGGTGG + Intronic
1062637608 9:137499827-137499849 AGGAGAGGTCAGAAGCCTGAAGG - Intronic
1185743718 X:2554747-2554769 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1185797613 X:2980445-2980467 GGGAGGCTTCACAATCATGGTGG - Intergenic
1185818993 X:3183775-3183797 GGGAGGCTTCACAATCATGGTGG - Intergenic
1185968385 X:4633523-4633545 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1185973435 X:4691095-4691117 GGGAGGCTTCACAATCATGGTGG - Intergenic
1186028912 X:5345811-5345833 GGGTGGCTTAAGAAGCCATATGG - Intergenic
1186231460 X:7459423-7459445 GGGAGGCTTCAGAATCATGGTGG - Intergenic
1186241425 X:7571216-7571238 GGGAGGCCTCACAATCCTGGTGG + Intergenic
1186277727 X:7957977-7957999 GGGAGGCCTCACAATCATGATGG + Intergenic
1186310382 X:8311239-8311261 GGGAGGCCTCACAATCCTGGCGG - Intergenic
1186335380 X:8581340-8581362 GGGAGGCCTCAGAATCATGGTGG - Intronic
1186485297 X:9929980-9930002 GGGAGGCCTCAGAATCATGGCGG - Intronic
1186655600 X:11608822-11608844 GGGAGGCCTCAGAATCATGGTGG - Intronic
1186831623 X:13396212-13396234 GGAAGGCCTCAGAATCATGACGG + Intergenic
1186890868 X:13957900-13957922 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1187527690 X:20068975-20068997 GGGAGGCCTCAGAATCATGGAGG - Intronic
1187556667 X:20358374-20358396 GGGAGGCTTCACAATCATGGTGG - Intergenic
1188124670 X:26352563-26352585 GGGAGGCTTCACAATCATGGTGG + Intergenic
1188428160 X:30073586-30073608 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1188614438 X:32140654-32140676 GGGAGGCCTCAGAATCATGGTGG + Intronic
1189371447 X:40432492-40432514 GGGAGGCCTCAGAATCATGACGG - Intergenic
1189378271 X:40482814-40482836 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1189616328 X:42788443-42788465 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1190497614 X:51041678-51041700 GGGAGGCCTCACAAGCATGGCGG + Intergenic
1191058327 X:56267319-56267341 GGGAGGCCTCAGAATCATGGTGG + Intronic
1191187034 X:57624102-57624124 GGGAGCCTACAGAAGCCGGCAGG - Intergenic
1191770963 X:64757822-64757844 GGGAGGCTTCACAATCATGGTGG - Intergenic
1191886958 X:65898857-65898879 GGGAGGATTCAGAATCATGGCGG + Intergenic
1192008660 X:67243527-67243549 GGGAGGCCTCACAATCATGATGG - Intergenic
1192162342 X:68797815-68797837 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1192162561 X:68799420-68799442 GGGAGACTTCAGAATCATGGTGG - Intergenic
1192282624 X:69701594-69701616 CGCAAGCTTCAGAAGCTTGACGG - Intronic
1192527588 X:71861155-71861177 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1192581315 X:72284460-72284482 GGGAGGCCTCAGAATCATGGCGG - Intronic
1192846159 X:74908971-74908993 GGGAGGCCTCAGAATCATGGCGG - Intronic
1192846441 X:74910894-74910916 GGGAGGCCTCAGAATCATGGTGG - Intronic
1192917135 X:75664911-75664933 GGGAGGCCTCAGAATCATGATGG + Intergenic
1192934778 X:75848436-75848458 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1192935022 X:75850239-75850261 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1193036611 X:76958012-76958034 GGGAGGCTTCAGTAGGGGGAGGG + Intergenic
1193222519 X:78943659-78943681 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1193498282 X:82239931-82239953 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1194215651 X:91127984-91128006 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1194264418 X:91737614-91737636 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1194474123 X:94336604-94336626 GGGAGACCTCAGAATCATGACGG - Intergenic
1194474818 X:94345943-94345965 GGGAGGCTTCACAATCATGCTGG + Intergenic
1194566297 X:95493456-95493478 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1194828808 X:98596082-98596104 GGGAGGCCTCAGAATCATGATGG + Intergenic
1194941658 X:100017376-100017398 GGGAGGCCTCACAATCCTGGTGG - Intergenic
1195195955 X:102498203-102498225 GGGAGGCCTCACAATCATGATGG - Intergenic
1195560499 X:106277173-106277195 GGGAGGCCTCACAATCCTGGTGG + Intergenic
1195561463 X:106289166-106289188 GGGAGGCCTCACAATCCTGGTGG - Intergenic
1195880589 X:109588839-109588861 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1196036501 X:111150498-111150520 GGGAGGCCTCAGAATCATGGTGG + Intronic
1196522083 X:116686218-116686240 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1196545398 X:116958558-116958580 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1196858337 X:120004481-120004503 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1197296479 X:124724918-124724940 AAGAGGCTTCAGGAGCCTGTTGG + Intronic
1197400226 X:125980401-125980423 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1197401725 X:126000621-126000643 GGGAGGCCTCAGAATCATGCCGG - Intergenic
1197511256 X:127371830-127371852 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1198707478 X:139464190-139464212 GGGAGGCCTCAGAATCATGGAGG - Intergenic
1199028023 X:142962166-142962188 GGGAGGCCTCACAATCCTGGTGG + Intergenic
1199112008 X:143946360-143946382 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1199113404 X:143960410-143960432 GGGAGGCCTCAGAATCATGATGG + Intergenic
1199191564 X:144977641-144977663 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1199290962 X:146104907-146104929 GGGAGGCCTCACAATCATGACGG + Intergenic
1199317915 X:146401587-146401609 GGGAGGCCTCACAATCATGAAGG - Intergenic
1199671032 X:150148561-150148583 GGGAGAGTGGAGAAGCCTGATGG - Intergenic
1199792447 X:151168006-151168028 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1199810008 X:151339806-151339828 CAGAGTGTTCAGAAGCCTGATGG + Intergenic
1199925536 X:152459439-152459461 GGGAGGCCTCAGAAACATGGGGG + Intergenic
1199942175 X:152637730-152637752 GGATGACTGCAGAAGCCTGAAGG + Intergenic
1200381723 X:155843870-155843892 GGGAGGCTTCACAATCATGGTGG - Intergenic
1201453892 Y:14147196-14147218 GGGAGGCTTCACAATCATGGTGG + Intergenic
1201545940 Y:15162158-15162180 GGGAGGCCTCACAATCATGATGG + Intergenic
1201640445 Y:16171450-16171472 AGGAGGCTTAAGAAGCTTTAAGG + Intergenic
1201662369 Y:16413875-16413897 AGGAGGCTTAAGAAGCTTTAAGG - Intergenic
1201867641 Y:18672157-18672179 GGGAGGCATAGGAAGCATGAGGG - Intergenic
1202019943 Y:20453694-20453716 GGAAGTCTTCAGAATCATGATGG - Intergenic