ID: 1069960070

View in Genome Browser
Species Human (GRCh38)
Location 10:72074239-72074261
Sequence CGCTTGCCAGCTTCCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069960070_1069960078 5 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960078 10:72074267-72074289 GCAGGCAGGGTGAGGCCTCCTGG No data
1069960070_1069960082 20 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960082 10:72074282-72074304 CCTCCTGGACAAAGGCCGAAGGG No data
1069960070_1069960083 21 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960083 10:72074283-72074305 CTCCTGGACAAAGGCCGAAGGGG No data
1069960070_1069960075 -9 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960075 10:72074253-72074275 TGGCAAGCGTCAGAGCAGGCAGG No data
1069960070_1069960077 -3 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960077 10:72074259-72074281 GCGTCAGAGCAGGCAGGGTGAGG No data
1069960070_1069960079 12 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960079 10:72074274-72074296 GGGTGAGGCCTCCTGGACAAAGG No data
1069960070_1069960080 19 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960080 10:72074281-72074303 GCCTCCTGGACAAAGGCCGAAGG No data
1069960070_1069960076 -8 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960076 10:72074254-72074276 GGCAAGCGTCAGAGCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069960070 Original CRISPR CGCTTGCCAGCTTCCAGGGG AGG (reversed) Intronic
900211054 1:1456067-1456089 CGCCTCCCATCTTCCAGGCGGGG + Intronic
900216880 1:1486386-1486408 CGCCTCCCATCTTCCAGGCGGGG + Intronic
900223961 1:1524115-1524137 CGCCTCCCATCTTCCAGGCGGGG + Intronic
900978724 1:6034325-6034347 CCTTTGCCACCTCCCAGGGGAGG - Intronic
903912815 1:26740547-26740569 GGCTGGTCAGCTTCCAGGGGTGG + Intronic
904365513 1:30008566-30008588 CCTTTGCCAGGCTCCAGGGGAGG - Intergenic
904657814 1:32062572-32062594 CCCTTCTCAGCTTACAGGGGAGG - Intergenic
905465815 1:38152348-38152370 GGCCTGCCAGATTCAAGGGGAGG + Intergenic
905767096 1:40610305-40610327 CCCATGGCAGCTTCCAGGTGGGG - Intergenic
906190687 1:43897886-43897908 CGTGCGCCAGCTTCCAGGGAAGG + Intronic
910101591 1:83583493-83583515 CACTTTCCAGCCTGCAGGGGTGG + Intergenic
910325065 1:85997404-85997426 CCCATCCCAGTTTCCAGGGGTGG + Intronic
915357990 1:155268121-155268143 CTCCTGCCAACTTACAGGGGTGG - Exonic
917513716 1:175689432-175689454 GGCCTGCAAGCTTCCAGGGAGGG + Intronic
919165395 1:193885396-193885418 CTCTTGCCTGCTTCCTGGAGTGG + Intergenic
921097140 1:211896243-211896265 CACTCGCCAGCTTCCTGGGGAGG - Intergenic
922740822 1:228013439-228013461 CACTTGCCAGTTTCCCTGGGCGG - Intronic
923497549 1:234538586-234538608 CTCTTGCCAGCTCTCAGGGGAGG - Intergenic
924137449 1:240984704-240984726 CTCTAGCCAGCCTCCAGGAGAGG - Intronic
1067317277 10:45180544-45180566 CCCCTGCAAGCTTCCAGGCGTGG - Intergenic
1067558645 10:47289278-47289300 CATTTCCCAGCTTTCAGGGGTGG - Intergenic
1068456692 10:57264393-57264415 AGCTTGCCTTCTGCCAGGGGAGG - Intergenic
1069741681 10:70689013-70689035 CCCCTGCCAGCCTCAAGGGGTGG - Intronic
1069901372 10:71708411-71708433 TGCTCGCCAGCTGGCAGGGGAGG + Intronic
1069960070 10:72074239-72074261 CGCTTGCCAGCTTCCAGGGGAGG - Intronic
1070327717 10:75399357-75399379 CGCTAGCCACCTGGCAGGGGCGG - Exonic
1071561379 10:86649131-86649153 GGTTGGCCAGCTTCCAGAGGAGG + Intergenic
1074943998 10:118263507-118263529 CACTTGCCATTTTCCTGGGGTGG + Intergenic
1075325784 10:121531233-121531255 CGGGTGCCAGCTCCCTGGGGTGG - Intronic
1077232594 11:1464734-1464756 CGCATGCCAGCTTCAAGGTGGGG + Intergenic
1078537406 11:12186070-12186092 CTCTTGCCAGCTGCAGGGGGAGG + Intronic
1081312771 11:41593758-41593780 CCCATGGCAGCTTCCAGGGCTGG + Intergenic
1083619573 11:64042284-64042306 CTCGTGGCAGCTTCCAGAGGTGG - Intronic
1084117747 11:67051890-67051912 CGCTTCTGATCTTCCAGGGGTGG - Intergenic
1084296582 11:68216210-68216232 CTCCTGCCAGCTGGCAGGGGAGG + Intergenic
1085331741 11:75657712-75657734 CCTTTGCCAGCTTCTAGAGGCGG + Intronic
1085719308 11:78899061-78899083 AGCTGGCCAGCTTCAAGAGGAGG - Intronic
1089377848 11:118007351-118007373 CGCTCACCAGCTACAAGGGGAGG + Intergenic
1089643955 11:119865719-119865741 GGTCAGCCAGCTTCCAGGGGAGG - Intergenic
1093685081 12:22046203-22046225 CGCGCGCCAGCTGCCAGGCGGGG + Exonic
1094716469 12:33019269-33019291 CCAGTGGCAGCTTCCAGGGGTGG - Intergenic
1095748141 12:45682396-45682418 CCCTTGGCAGCGTCAAGGGGTGG - Intergenic
1096117694 12:49065040-49065062 CACTTGCCATGTTCCAGTGGGGG - Exonic
1096649781 12:53056495-53056517 CTCTTTCTAGCTTCCAGTGGTGG + Intronic
1101469979 12:104986751-104986773 AGCTTCCCAGCTTCCAGGGCAGG - Intronic
1103440751 12:120961156-120961178 GTCTTGCCAGCCTTCAGGGGAGG - Intergenic
1103480125 12:121245331-121245353 CCCCTGCCAGCTCCCAGGGCTGG + Intronic
1103510985 12:121474059-121474081 CGGTTGCCAGGGACCAGGGGAGG + Intronic
1103932792 12:124459432-124459454 TGCTTGTCAGCCTCCTGGGGAGG + Intronic
1104635640 12:130436728-130436750 CGCATCCCAGCTTGCAGGGAGGG - Intronic
1117164138 14:53017143-53017165 AACATGCCAGCTTCCAGGGGAGG + Intergenic
1117971461 14:61254932-61254954 CGCCTGCCAGGTTCCAGGAAGGG + Intronic
1118708085 14:68498482-68498504 CCCTAGCCAGGTTCCAGTGGTGG + Intronic
1121099042 14:91237227-91237249 CACTTCCCACCTTCCAGGTGAGG + Intronic
1121121738 14:91380049-91380071 CCCTTGCCAGCTTCCGGAGCAGG + Intronic
1122724332 14:103740315-103740337 CGTTGGCCAGCTTCCTGCGGAGG + Exonic
1122974777 14:105166569-105166591 CTGTGGCCAGCTTCCACGGGTGG + Intronic
1123451005 15:20358641-20358663 CACGTGCCAGCTGCCAGGAGGGG - Intergenic
1128646564 15:69382986-69383008 AGCTTGCATGCTTCCAGGGATGG - Intronic
1129288683 15:74546365-74546387 CGCTGGCCAGCTGCCAAGGCGGG - Intronic
1129377742 15:75144916-75144938 CCCTCGCCAGCTTCAAGGTGAGG + Intergenic
1130192445 15:81749978-81750000 AGCTTGCCAGCAGCCAGGGCCGG + Intergenic
1137686477 16:50390414-50390436 TGTTTGCCAGGTTCCAGGGGAGG - Intergenic
1137718146 16:50611437-50611459 GGCCTCCCAGCTTCCAGGGCAGG + Intronic
1137964191 16:52914587-52914609 CACATGGCAGCTTCTAGGGGTGG - Intergenic
1138991260 16:62393012-62393034 CCCTTCCCTGCTGCCAGGGGTGG - Intergenic
1139433248 16:66922425-66922447 CGAGTGGCAGCTTCCATGGGTGG - Intronic
1142682831 17:1560510-1560532 CCCTTGCAGGCTTCAAGGGGAGG + Intronic
1144163247 17:12582105-12582127 CCCATGCCAGCATCTAGGGGAGG - Intergenic
1144373991 17:14620716-14620738 AGCTGGGCAGCTTCCAGTGGAGG + Intergenic
1148075771 17:44934501-44934523 CCCATGCCATCTTCCAGGTGAGG - Exonic
1149386732 17:56149872-56149894 AGCTGTCCAGCTTCCAGGGTTGG + Intronic
1151598682 17:75093437-75093459 CTCTGGCCACCTCCCAGGGGTGG + Intronic
1152078504 17:78172517-78172539 CCCTTCCCTGCTGCCAGGGGTGG - Exonic
1152371805 17:79892944-79892966 GGCCTCCCAGCCTCCAGGGGAGG - Intergenic
1152376414 17:79921014-79921036 GGCTTGCCAGCATCCTGGGGAGG + Intergenic
1156454741 18:37286644-37286666 CACTGGCCATCTTCCCGGGGAGG + Intronic
1157271437 18:46279381-46279403 CTCCTTCCAGCTTCCAGGGAAGG - Intergenic
1160451056 18:78966220-78966242 TGCTACCCAGCTTCCTGGGGTGG - Intergenic
1162145939 19:8611981-8612003 CTCTGGCCAGCTCCCTGGGGGGG - Intergenic
1166064396 19:40348592-40348614 CGCTTGCTAGCTTCGGGCGGAGG - Intronic
1166859034 19:45799046-45799068 CTCTTCCCAGCTTCCAGAGAAGG + Intronic
1167284103 19:48589128-48589150 CGCTGGCCGGGGTCCAGGGGAGG + Intronic
1168151311 19:54450235-54450257 CCCCTGCCTGCTTCCACGGGAGG - Intronic
929404083 2:41621139-41621161 CTCAAGCCACCTTCCAGGGGAGG + Intergenic
933699448 2:85244119-85244141 CGCTTGGTAGGTTCCAGGAGCGG + Intronic
937911331 2:127077051-127077073 CACTTTTCAGCTTCCAGGGTGGG - Intronic
938536345 2:132252626-132252648 CGCTGGGCCGCCTCCAGGGGTGG + Intronic
944522663 2:200587442-200587464 CACTGGTTAGCTTCCAGGGGAGG - Intronic
947928120 2:233938889-233938911 CGCTTGCCTGCTTCTAGAAGAGG - Intronic
948781390 2:240323980-240324002 AGCTTCCCAGCTCCCAGGGTCGG - Intergenic
1171405680 20:24910885-24910907 CTCTCACCAGCTCCCAGGGGAGG - Intergenic
1172882895 20:38213247-38213269 GCCTGGCCAGCTTCCTGGGGTGG + Exonic
1175967727 20:62667941-62667963 CCCTTCCCAGGGTCCAGGGGAGG - Intronic
1176266722 20:64213156-64213178 CCCTTCCCAGCTTGCAGGGCTGG - Intronic
1177438785 21:21090753-21090775 CAATTGCAAGCTTGCAGGGGTGG - Intronic
1180147801 21:45930935-45930957 CAGTTTCCAGCTTCCATGGGAGG + Intronic
1181712257 22:24697863-24697885 AGCATGCCAGCTGCCCGGGGAGG - Intergenic
1181962159 22:26629964-26629986 AGCTTGCCTGCTGGCAGGGGAGG + Intronic
1184797972 22:46742710-46742732 AGCTTACCAGCACCCAGGGGAGG + Intergenic
1185095723 22:48804985-48805007 CGCTGGCCTGCTTCCTGGGCAGG + Intronic
950490416 3:13301358-13301380 GGCCTGCCGGCTTCCAGGAGGGG - Intergenic
950749940 3:15120512-15120534 TGCTTGCCTGCCTCCAGGGATGG - Intergenic
952160673 3:30690337-30690359 CTCTTGCCACCTTCCTGGGCAGG + Intronic
953930389 3:47002969-47002991 CGCTGGACAGTTTCCAGCGGGGG - Exonic
954228652 3:49199555-49199577 CGCGTGCCAGCAGCCAGAGGTGG + Intronic
956182229 3:66528136-66528158 TCCTTGCCAGCTTCTAGGGATGG - Intergenic
960947786 3:122978673-122978695 CGCTGGGCAGCCTCCAGGGGTGG + Intronic
961010949 3:123435499-123435521 GGCCTGCCAGCTTCCTGGAGAGG - Intronic
961449939 3:126998142-126998164 CGCTTCCCAGCATCCACGGGGGG - Intronic
968632342 4:1658574-1658596 GGCTTTCCTGCTTCCAGGGAGGG - Intronic
968688765 4:1978921-1978943 CGCTTGGCCGGATCCAGGGGCGG + Exonic
969700769 4:8766395-8766417 TGCTTCCCAGCTTACAGGTGGGG + Intergenic
971248934 4:24955704-24955726 TGGTTGCCAGAATCCAGGGGAGG + Intronic
972403939 4:38729403-38729425 CCGTTGCCAGCTTGCAGGGGAGG - Intergenic
974987164 4:69042246-69042268 CCCATGGCAGCATCCAGGGGTGG - Intronic
975321026 4:73010975-73010997 CTCCTGGGAGCTTCCAGGGGAGG - Intergenic
979530474 4:121764811-121764833 GGCCTCCCAGCTTCCAGGTGCGG - Exonic
982260115 4:153487494-153487516 TGCAGGTCAGCTTCCAGGGGAGG + Intronic
987062731 5:14258041-14258063 GGCTTGCCACCTCCCAGGGGGGG - Intronic
995494440 5:112726109-112726131 CCCCTGGCAGCATCCAGGGGTGG + Intronic
996530725 5:124524258-124524280 CCCATGGCAGCTTCCAGTGGAGG - Intergenic
1002773052 6:305631-305653 GGCTTGTCGGCTTCCAGGGAGGG + Intronic
1003384230 6:5652614-5652636 CGCTTGCCAACTTCCAGGGAAGG + Intronic
1017510570 6:155111150-155111172 CTTTTTCCACCTTCCAGGGGTGG - Intronic
1023310443 7:38881193-38881215 CTCCCCCCAGCTTCCAGGGGAGG - Intronic
1030995052 7:116350181-116350203 CGCTGGTCAGCCTACAGGGGTGG + Intronic
1031972982 7:128077182-128077204 TGCTTGCAAGGCTCCAGGGGTGG - Intronic
1035067388 7:156117001-156117023 CTCTGGCCAGCGTCCAGAGGCGG - Intergenic
1036187680 8:6638389-6638411 CGATTGCCAGCATCCAAGTGTGG - Intronic
1037601166 8:20395335-20395357 CTCTTGCCAGCTGGCAGGGCTGG + Intergenic
1037655213 8:20877211-20877233 TGCTTTCCTGCTTCCAGGAGTGG - Intergenic
1044573976 8:93748780-93748802 GGCTTGGCAGCATCCAGGGAAGG + Intergenic
1045245117 8:100435889-100435911 CCCTTTCCAGCTTCTAGAGGCGG + Intergenic
1047295898 8:123570342-123570364 CGCTTTCCTGCATCCAGGTGTGG + Intergenic
1049240923 8:141537034-141537056 CCCTTCCCAGCTACCCGGGGCGG + Intergenic
1049818748 8:144621363-144621385 AGCTTGCCAGTTCCCAGGGGTGG + Intergenic
1056961650 9:91129988-91130010 TGCTTGCCATCTTACAGAGGAGG + Intergenic
1058021860 9:100098616-100098638 CGCCTGTCGGCTTCCAGGCGCGG - Intronic
1060557655 9:124517395-124517417 CCCTTGCCAGCTGGCAGGGTGGG + Exonic
1060677438 9:125528285-125528307 CCCTTCCCAGCTTCCATGGCTGG + Intronic
1197468477 X:126837138-126837160 CACATGCCTGCTGCCAGGGGAGG - Intergenic
1198853875 X:140995588-140995610 CCCATGGCAGCATCCAGGGGTGG + Intergenic
1198878139 X:141249518-141249540 CCCATGGCAGCATCCAGGGGTGG - Intergenic
1200787781 Y:7274556-7274578 CGGGTGCCCGCTTCCTGGGGAGG + Intergenic