ID: 1069960076

View in Genome Browser
Species Human (GRCh38)
Location 10:72074254-72074276
Sequence GGCAAGCGTCAGAGCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069960067_1069960076 9 Left 1069960067 10:72074222-72074244 CCTTCAGGCTTCTGAAGCCTCCC 0: 1
1: 0
2: 4
3: 101
4: 1277
Right 1069960076 10:72074254-72074276 GGCAAGCGTCAGAGCAGGCAGGG No data
1069960070_1069960076 -8 Left 1069960070 10:72074239-72074261 CCTCCCCTGGAAGCTGGCAAGCG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1069960076 10:72074254-72074276 GGCAAGCGTCAGAGCAGGCAGGG No data
1069960066_1069960076 15 Left 1069960066 10:72074216-72074238 CCAAGGCCTTCAGGCTTCTGAAG 0: 1
1: 1
2: 7
3: 132
4: 914
Right 1069960076 10:72074254-72074276 GGCAAGCGTCAGAGCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069960076 Original CRISPR GGCAAGCGTCAGAGCAGGCA GGG Intronic
No off target data available for this crispr