ID: 1069961169

View in Genome Browser
Species Human (GRCh38)
Location 10:72080396-72080418
Sequence CACTGAAGAAGGCCCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069961155_1069961169 30 Left 1069961155 10:72080343-72080365 CCATTATTTTGGCCTCATTCCTC 0: 1
1: 0
2: 1
3: 38
4: 336
Right 1069961169 10:72080396-72080418 CACTGAAGAAGGCCCAGGACTGG No data
1069961164_1069961169 -4 Left 1069961164 10:72080377-72080399 CCTGTGATGGAGGCCAGTCCACT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1069961169 10:72080396-72080418 CACTGAAGAAGGCCCAGGACTGG No data
1069961161_1069961169 11 Left 1069961161 10:72080362-72080384 CCTCAGGCAACGGGGCCTGTGAT 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1069961169 10:72080396-72080418 CACTGAAGAAGGCCCAGGACTGG No data
1069961160_1069961169 18 Left 1069961160 10:72080355-72080377 CCTCATTCCTCAGGCAACGGGGC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1069961169 10:72080396-72080418 CACTGAAGAAGGCCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069961169 Original CRISPR CACTGAAGAAGGCCCAGGAC TGG Intronic
No off target data available for this crispr