ID: 1069961249

View in Genome Browser
Species Human (GRCh38)
Location 10:72080695-72080717
Sequence CTGGATAAACAGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069961243_1069961249 13 Left 1069961243 10:72080659-72080681 CCTCTCTTGGAGGGGGCGGCAGA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069961249 Original CRISPR CTGGATAAACAGAAGGAGAC AGG Intronic
No off target data available for this crispr