ID: 1069963196

View in Genome Browser
Species Human (GRCh38)
Location 10:72091015-72091037
Sequence CCTCCGCCTCCCAAGTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069963192_1069963196 17 Left 1069963192 10:72090975-72090997 CCAGGCTGGAGAGCAGTGGTGCG 0: 169
1: 21396
2: 108412
3: 192702
4: 219862
Right 1069963196 10:72091015-72091037 CCTCCGCCTCCCAAGTTTAAGGG No data
1069963191_1069963196 18 Left 1069963191 10:72090974-72090996 CCCAGGCTGGAGAGCAGTGGTGC 0: 453
1: 47741
2: 134720
3: 204164
4: 192756
Right 1069963196 10:72091015-72091037 CCTCCGCCTCCCAAGTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069963196 Original CRISPR CCTCCGCCTCCCAAGTTTAA GGG Intergenic
No off target data available for this crispr