ID: 1069966971

View in Genome Browser
Species Human (GRCh38)
Location 10:72127461-72127483
Sequence AGGCTGTTCCTGAGTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069966969_1069966971 -3 Left 1069966969 10:72127441-72127463 CCATCTACTTTTTAGGACATAGG 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1069966971 10:72127461-72127483 AGGCTGTTCCTGAGTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069966971 Original CRISPR AGGCTGTTCCTGAGTAAAAA TGG Intronic
No off target data available for this crispr