ID: 1069969948

View in Genome Browser
Species Human (GRCh38)
Location 10:72158579-72158601
Sequence GATGCTATGAGACCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069969948 Original CRISPR GATGCTATGAGACCAAAAAC AGG (reversed) Intronic
901358199 1:8671040-8671062 CATGCAAAGAGAACAAAAACTGG + Intronic
904388159 1:30160822-30160844 GATGATATGATATCAAAATCAGG - Intergenic
905620583 1:39442505-39442527 GATGCTCAGAGACCAATAAGTGG + Exonic
910293140 1:85617829-85617851 GATGGTATGTGAACAAAAGCAGG + Intergenic
910875803 1:91876606-91876628 GATGCTGTGAGCCCATAACCTGG + Intronic
914855303 1:151346280-151346302 GATGCTAAGAGCCCCAAGACTGG - Exonic
918877877 1:190073008-190073030 CATTCTATGAGGCCAAAATCTGG - Intergenic
921952654 1:220946540-220946562 GGTGCTATCAGACCAAATACTGG - Intergenic
1064061585 10:12142111-12142133 GATGCTATTACACAAATAACAGG - Intronic
1064684087 10:17841361-17841383 GATGTTATTAAATCAAAAACAGG - Intronic
1068444111 10:57097896-57097918 GCTGTGATGAGAACAAAAACTGG - Intergenic
1068571845 10:58638510-58638532 GAAGCACTGAGACCAAAAAGGGG - Intronic
1069677468 10:70258896-70258918 CAGGCTATCAGGCCAAAAACTGG - Intronic
1069969948 10:72158579-72158601 GATGCTATGAGACCAAAAACAGG - Intronic
1070950544 10:80427587-80427609 AAGGCTAGGAGACCCAAAACAGG - Intronic
1073073902 10:100811503-100811525 GATGCAAGGAGAACAGAAACAGG + Intronic
1077641816 11:3888134-3888156 GCTGCTATGGGGCCAGAAACAGG + Intronic
1080142194 11:28935326-28935348 GATGTTATGAGACGAATAAAAGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1085227386 11:74934529-74934551 GATGCTATGAGACATATAACAGG + Intronic
1086858389 11:91895162-91895184 GATAGTATGAGAGCCAAAACTGG - Intergenic
1087740356 11:101880273-101880295 GATGCTTTGGAAACAAAAACAGG - Intergenic
1087858512 11:103123842-103123864 GATTCTATGGGACAAAAAATGGG - Intronic
1088786629 11:113188180-113188202 GATGCTGTTAGACAAAAGACGGG + Intronic
1089537926 11:119172260-119172282 GCTGCTATGAGAGCAAATACTGG + Intronic
1090238746 11:125167057-125167079 GAGATTATGAGACCAGAAACGGG - Intronic
1090900013 11:131021173-131021195 GCTGCTATAACACCATAAACTGG - Intergenic
1097951678 12:65436560-65436582 GATGCTATAACACCCAAATCAGG - Intronic
1099274930 12:80563141-80563163 GCTGCTATAATACCAGAAACTGG + Intronic
1101084340 12:101220410-101220432 GATCCCATGAGGCCAAAAGCAGG + Intergenic
1103478280 12:121234109-121234131 CATGCTATGAGACAACAGACAGG - Intergenic
1107033184 13:35874334-35874356 GATGTTATAAGACTACAAACAGG + Intronic
1107134963 13:36933693-36933715 TATGGTATAAGACCAAAACCAGG + Intergenic
1107882425 13:44844188-44844210 GAGGCAATGAGAACTAAAACAGG + Intergenic
1109157604 13:58930154-58930176 GAAGCTACCAGAACAAAAACTGG - Intergenic
1109728844 13:66383206-66383228 GATGCAATGAGCACAAAAAATGG + Intronic
1111199619 13:84916334-84916356 TATGCTATGAGTACAAAAACAGG - Intergenic
1111801801 13:92990064-92990086 TATGCTATGAGACAAAAGTCGGG - Intergenic
1112252797 13:97798924-97798946 GATGTTTTTACACCAAAAACAGG + Intergenic
1112993526 13:105543801-105543823 AAATCTATGAGACCAAAAATAGG - Intergenic
1113214202 13:108018910-108018932 TATGCTCTCAGACCAAAAAATGG + Intergenic
1113418490 13:110150984-110151006 TCTGCTTTGAGACCAAAAAGAGG + Intronic
1114651285 14:24286202-24286224 GATGCCATGAAACCAGCAACAGG - Intergenic
1117971649 14:61256875-61256897 AAAGCTATGAGACCAAAACCAGG - Intronic
1120017483 14:79490117-79490139 TATTCTATGAGAATAAAAACAGG + Intronic
1120552977 14:85893801-85893823 GATGGCATGAGAACAAAACCTGG + Intergenic
1121363819 14:93288429-93288451 GATGCTATTAAAGTAAAAACAGG - Intronic
1121388436 14:93552306-93552328 GATGCTTTGAGCCTAATAACTGG - Intronic
1123462367 15:20485019-20485041 GGTTCTAAGAGACCAAAATCTGG - Intergenic
1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG + Intergenic
1124160466 15:27263981-27264003 GATGCTTTGAGAACATATACCGG + Intronic
1125827237 15:42686815-42686837 CATTCTATGTGACCAAAAGCAGG + Exonic
1127826193 15:62705572-62705594 GATTCTATGTGACCAAATCCTGG + Intronic
1128894687 15:71361741-71361763 AATGCTATGGGAGAAAAAACGGG + Intronic
1129151832 15:73693965-73693987 GATGCCATGAGAACAAATTCTGG - Intronic
1129162963 15:73757388-73757410 AAGGCCATGAGAACAAAAACTGG - Intergenic
1129378509 15:75150712-75150734 GATACTATGAAACCAAAAGGGGG + Intergenic
1129662569 15:77561261-77561283 GATGTTATGAAACATAAAACTGG - Intergenic
1131605090 15:93895232-93895254 GATCAGATGAGACCAAAAAAGGG + Intergenic
1131940150 15:97553973-97553995 GATGCAATGAGAAAAAAAAGGGG + Intergenic
1132293942 15:100721226-100721248 GATTCTGTGAGACTCAAAACAGG - Intergenic
1134865765 16:17605318-17605340 GATTTTATTTGACCAAAAACTGG - Intergenic
1136664549 16:31797963-31797985 CATTCTATGAGGCCAAAACCTGG - Intergenic
1139377036 16:66505935-66505957 GATGTTTGGAGACCAAGAACTGG + Intronic
1140745561 16:77977330-77977352 GAAGAAATGAGACCAAAAAGGGG - Intronic
1146100976 17:29981483-29981505 GATGCTATGAGAGCACATAAGGG - Intronic
1150114211 17:62530620-62530642 TATTTTATGAGACCAAAAAAAGG - Intronic
1151146238 17:72044191-72044213 AATGCTATGAAGCCATAAACAGG + Intergenic
1153506567 18:5805399-5805421 AATTCAATGAAACCAAAAACTGG - Intergenic
1155847514 18:30728105-30728127 GATGCTATGAGAGCAGAATGAGG + Intergenic
1157786448 18:50487585-50487607 AATCCTATGAAAACAAAAACAGG + Intergenic
1159033851 18:63258550-63258572 GATGTTATCAGAACAAAACCTGG + Intronic
1161962562 19:7530617-7530639 GACTCTATGAAACCAAAAAGAGG + Intronic
1164485139 19:28649677-28649699 GTGGCTAAGAGAACAAAAACAGG - Intergenic
925240381 2:2320617-2320639 CAGGATATGAGGCCAAAAACAGG + Intronic
927742284 2:25582270-25582292 GATGCCATCAGACCAACCACCGG + Intronic
928364245 2:30689442-30689464 GAGGCTATGAGACCAAGGAAAGG + Intergenic
932113652 2:69024795-69024817 GAAGCAAAGAGACCAATAACTGG - Intronic
938037752 2:128050081-128050103 CATTCTATGAGGCCAAAACCAGG - Intergenic
941874689 2:170420731-170420753 AGTGCCATGAGACCAGAAACTGG + Intronic
942684324 2:178515013-178515035 AATGTTATAAGACCAAAAATTGG - Exonic
945039330 2:205730932-205730954 GATGGGAAGAGACCAAGAACAGG - Intronic
947961068 2:234237948-234237970 GATGGTATAAGAACAAAAACTGG - Intergenic
948331187 2:237166970-237166992 GATGAGAAGAGAACAAAAACAGG - Intergenic
1168730058 20:69287-69309 GATGCTGTGGGACCAACAACAGG + Intergenic
1169343014 20:4810505-4810527 GATGCTCTGAGACCAAGGAAAGG - Intronic
1170628710 20:18049832-18049854 GATGATATGAGACAAACAATGGG - Intronic
1171777862 20:29387568-29387590 GATTCTATGAGACACAAACCTGG - Intergenic
1172650477 20:36498554-36498576 GCTGCAATGAGACCAAGAATGGG - Intronic
1173963877 20:47096872-47096894 GTTGATAAGAGCCCAAAAACTGG + Intronic
1176216003 20:63948067-63948089 GATGCCATGAGACAAGACACAGG + Intronic
1176519004 21:7811119-7811141 GATGTTTTGTGACCAGAAACAGG + Intergenic
1177549756 21:22605227-22605249 GAAGATATGAGAACTAAAACTGG - Intergenic
1178653032 21:34441132-34441154 GATGTTTTGTGACCAGAAACAGG + Intergenic
1181871621 22:25903672-25903694 GATGCTACAGGACCATAAACGGG + Exonic
951160886 3:19419944-19419966 TATCCTATGAGACTAAACACAGG - Intronic
952004731 3:28830235-28830257 AAAGCAATGAGACCAAAACCTGG + Intergenic
952940961 3:38444098-38444120 CATGCTATGAGATCAAACCCTGG - Intergenic
954913430 3:54128582-54128604 GATGCTATGATGCCAACAAACGG + Intronic
955995470 3:64676235-64676257 GATCCTAAGAGACCAAAATGTGG + Intronic
958531173 3:95332730-95332752 GATGGTGTGGTACCAAAAACAGG + Intergenic
958682503 3:97349977-97349999 GGTCCTCTTAGACCAAAAACTGG - Intronic
960407246 3:117276942-117276964 GGAGATATGAGACTAAAAACAGG - Intergenic
961449327 3:126995359-126995381 GATGCTACAGGACCCAAAACAGG - Intronic
962536258 3:136331736-136331758 GATACTAAGAAAACAAAAACAGG - Intronic
963643693 3:147887540-147887562 GATGCTGTGAGTGCAAAATCAGG + Intergenic
963924409 3:150936373-150936395 GTTGCTATGAGACCACCAAGTGG - Intronic
964695580 3:159504152-159504174 GATGATAGGAGCCCAAACACAGG + Intronic
966068873 3:175850215-175850237 TATGATATGAGTCCAAGAACTGG - Intergenic
966168550 3:177050481-177050503 GATGCTAGGAGATCACTAACAGG + Exonic
971212811 4:24636175-24636197 GTTGCTATAATACCATAAACTGG - Intergenic
971271643 4:25154707-25154729 CATGCTAAGAGATCAGAAACAGG + Intronic
972561346 4:40231692-40231714 GATGCTGTGAGACAAGAAAGAGG - Intronic
973232021 4:47851055-47851077 GATGCTAAGAGACATAAATCTGG + Intronic
974402186 4:61421913-61421935 GATGTTTTTAGACCAAAAAGCGG - Intronic
977413340 4:96696313-96696335 GTTTATATGAGATCAAAAACAGG - Intergenic
978041660 4:104071555-104071577 GATTCTCTGAGATCAAAAAAGGG + Intergenic
978412104 4:108436906-108436928 GTTCATATGGGACCAAAAACGGG - Intergenic
980339044 4:131518296-131518318 GATGTTATGAGAGGTAAAACTGG - Intergenic
980664293 4:135908687-135908709 GATGAAATAAGACCAAAAAAAGG - Intergenic
980785167 4:137543728-137543750 AATGTTAGGAGACCAAACACAGG - Intergenic
983061185 4:163162639-163162661 GACACTATGAGAGCAGAAACTGG + Intronic
983663958 4:170161586-170161608 AATGCTAAGACATCAAAAACAGG + Intergenic
985122056 4:186653938-186653960 GGTGCCATCAGACCAAAAATGGG - Intronic
985937298 5:3106748-3106770 GATGTTATCAGAAGAAAAACAGG - Intergenic
986521629 5:8625292-8625314 AATGCTATGAAAACAAAAATAGG - Intergenic
988660407 5:33261063-33261085 GAAGCTAGAAGACCAAATACAGG + Intergenic
990716786 5:58646195-58646217 GACGCTATGAGAACAGAAAGGGG - Intronic
991050755 5:62270764-62270786 GATGCAATCTGACCATAAACAGG - Intergenic
994286582 5:97976209-97976231 GCTGCTATGAGACTAAAATAAGG - Intergenic
997968311 5:138378132-138378154 GATGCTCTTAGAACAAAAACAGG + Intronic
999611666 5:153376434-153376456 AATGCTATGTGAGCAGAAACAGG + Intergenic
1002084301 5:176762305-176762327 TATGCCAAGACACCAAAAACTGG + Intergenic
1004156487 6:13172761-13172783 GATTCTTTGAGTACAAAAACAGG + Intronic
1005023071 6:21436060-21436082 GTTGCTATGAGCCAAGAAACAGG + Intergenic
1005335286 6:24790034-24790056 GATGCAATGAGACCAAATAAAGG + Intergenic
1007538355 6:42617120-42617142 ACTGCTATGAGAACAATAACTGG - Intronic
1008363981 6:50654264-50654286 GATGCTATGTGACTAAAACTAGG - Intergenic
1008443182 6:51556449-51556471 CATGATAAGAGACAAAAAACTGG + Intergenic
1014662302 6:124188168-124188190 GATGCTATTGGACCAAATTCAGG - Intronic
1015036330 6:128659473-128659495 GATGTTAGGAGACCACAAACAGG + Intergenic
1016585688 6:145681934-145681956 GATGCTTTGAGAGTAAAAAGAGG - Intronic
1019904729 7:4053235-4053257 GAGGCTGGGAGTCCAAAAACGGG - Intronic
1020470883 7:8533108-8533130 AATGCTGTGTGACCTAAAACAGG - Intronic
1021254738 7:18377058-18377080 GTTGCTATAAGAACAGAAACTGG - Intronic
1022055943 7:26734544-26734566 GCTGCTATAATACCCAAAACTGG + Intronic
1023476813 7:40589078-40589100 GCTGCTATGACACCAATTACTGG - Intronic
1024688535 7:51774482-51774504 GAAGCTATGAGAACAATATCTGG - Intergenic
1024914084 7:54479651-54479673 AATGCTATGAGAACAAACAATGG + Intergenic
1026604497 7:71804293-71804315 GAAGCTATGAGTTCAAGAACAGG + Intronic
1029657767 7:101938427-101938449 GATGAAATGTAACCAAAAACAGG - Intronic
1030829247 7:114200648-114200670 GATGCCATTTGACCAAGAACTGG + Intronic
1032043913 7:128586389-128586411 TATTTTATGAGACCAAAAAAAGG - Intergenic
1032394215 7:131577542-131577564 GATCCTATGAGGACAAACACTGG + Intergenic
1043071986 8:75648711-75648733 GATGCTTTGAGACTAAGTACAGG + Intergenic
1043858344 8:85287436-85287458 GATGCTGAGAGACCAAACAGAGG + Intergenic
1045849624 8:106678073-106678095 GATGCTATGTGACTAATAACAGG + Intronic
1045885371 8:107090377-107090399 GAGGCTATGTGATCAGAAACAGG - Intergenic
1046872685 8:119221132-119221154 GAAGCAATGAGATCAAAAGCTGG + Intronic
1046910018 8:119615718-119615740 GATGCTATAATAACAGAAACAGG - Intronic
1047030870 8:120879239-120879261 GATGCTGTGAGATCAAAGAAGGG + Intergenic
1047757146 8:127927365-127927387 AAAGCAATGAGACCAGAAACGGG - Intergenic
1050194355 9:3065407-3065429 GATGCAATGAGACCACAGAATGG - Intergenic
1051894046 9:21970182-21970204 GATGCTTTGAGATCACAAAAAGG + Intronic
1052310565 9:27063628-27063650 CATGATATCAGAGCAAAAACAGG - Intergenic
1053474456 9:38372041-38372063 CATGCTATGTGACCACAGACTGG + Intergenic
1056607413 9:88097756-88097778 GATGATAGGAGATCAAGAACTGG - Intergenic
1059549201 9:115211510-115211532 CATGCTATGGGAACAAAATCAGG + Intronic
1186593563 X:10956585-10956607 CATTCTATGAGGCCAAAACCTGG + Intergenic
1186782393 X:12926209-12926231 CATGCTAATAGACCAATAACAGG + Intergenic
1186874647 X:13804840-13804862 GATGGTATGAGGCAAAAAATAGG - Intronic
1188628470 X:32318624-32318646 GAAGCTATGTAACCAAAAAAAGG + Intronic
1190280477 X:48925963-48925985 GATGCTAGAAGACAAGAAACGGG - Exonic
1192703385 X:73500638-73500660 GCTGCTATGATACTAAAATCAGG - Intergenic
1193014629 X:76718893-76718915 AATGTTATGAGACCAAGAATAGG + Intergenic
1193057799 X:77173303-77173325 GATGCTATGAGATCACAGAAGGG + Intergenic
1193987504 X:88262995-88263017 AATACTATGACACCAAAATCTGG - Intergenic
1196474842 X:116070257-116070279 AATACTAGGAAACCAAAAACTGG - Intergenic
1197244256 X:124151895-124151917 GATGCTTTGAGACCAACATCTGG - Intronic
1197679890 X:129371145-129371167 GGTGCTATGAGGCCCAAAAGGGG + Intergenic
1199690967 X:150308788-150308810 GATGCTATGGGACCACAGGCTGG + Intergenic