ID: 1069976286

View in Genome Browser
Species Human (GRCh38)
Location 10:72215993-72216015
Sequence GCGTGCGCGCGCCCGTGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069976286_1069976297 23 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
1069976286_1069976295 9 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976295 10:72216025-72216047 CGCTGGCTCCGTCTGTTGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1069976286_1069976287 -8 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976286_1069976294 8 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976294 10:72216024-72216046 CCGCTGGCTCCGTCTGTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 78
1069976286_1069976291 6 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976291 10:72216022-72216044 CGCCGCTGGCTCCGTCTGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1069976286_1069976290 5 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976286_1069976292 7 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976292 10:72216023-72216045 GCCGCTGGCTCCGTCTGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069976286 Original CRISPR GCGTGCGCGCGCCCGTGCCG TGG (reversed) Exonic