ID: 1069976286

View in Genome Browser
Species Human (GRCh38)
Location 10:72215993-72216015
Sequence GCGTGCGCGCGCCCGTGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069976286_1069976291 6 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976291 10:72216022-72216044 CGCCGCTGGCTCCGTCTGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1069976286_1069976295 9 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976295 10:72216025-72216047 CGCTGGCTCCGTCTGTTGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1069976286_1069976287 -8 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976286_1069976297 23 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
1069976286_1069976294 8 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976294 10:72216024-72216046 CCGCTGGCTCCGTCTGTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 78
1069976286_1069976292 7 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976292 10:72216023-72216045 GCCGCTGGCTCCGTCTGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1069976286_1069976290 5 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069976286 Original CRISPR GCGTGCGCGCGCCCGTGCCG TGG (reversed) Exonic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
902350026 1:15847645-15847667 ACGCGCGCGCGCCCGCGGCGAGG + Intergenic
903879824 1:26500969-26500991 CCACGCGCGCGCACGTGCCGGGG + Intergenic
905031214 1:34885609-34885631 GTGTGCGCGCACCCATGGCGGGG + Exonic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905066845 1:35192092-35192114 GCTTGCGCGCGCCGCTGCGGGGG - Intronic
905231835 1:36519251-36519273 GCGCGCGCGCTCACGTGCAGGGG + Intergenic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
912416240 1:109509768-109509790 GCGTGCGCGCGGCGGGGGCGGGG + Intergenic
914702943 1:150150375-150150397 GCGGGGGCGCGGCCGGGCCGTGG - Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915429769 1:155857223-155857245 GCGTGCGCGTCCCCGAGCCTCGG + Exonic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
920922643 1:210311137-210311159 TCGTGCGCGCGCACGTGGCGGGG - Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
924732414 1:246724257-246724279 GCGTGGGCGCGGCCCTGGCGCGG + Exonic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1069495584 10:68900912-68900934 GCGTGGGCAGGCCCATGCCGAGG - Intergenic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1079630344 11:22666944-22666966 GCGTGCGCGCACCGCAGCCGGGG + Intronic
1082035554 11:47642567-47642589 GCGTGCGTGCGCGCGCGCCGCGG - Exonic
1082775670 11:57242597-57242619 GCGCGCACGCGCGCGTGCCTAGG - Intergenic
1084086289 11:66856843-66856865 GGGCGCGCGCGCCTGTGCCAGGG + Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1088462090 11:110093023-110093045 GCTCGGGCGCGCCCGAGCCGGGG + Intergenic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1104961671 12:132490946-132490968 GCTTGCGACCGCCCGCGCCGTGG + Intronic
1106735664 13:32586259-32586281 GCGTGCGCGCGGACGGGGCGGGG + Intergenic
1113653938 13:112056727-112056749 GTGTGCGCGCGCGCGAGGCGAGG + Intergenic
1119046398 14:71321370-71321392 GCGTGCGCGCGCGCCGGGCGCGG - Intronic
1122183425 14:99971766-99971788 GTGTGCGCGGGCGCGTGCCTGGG - Intronic
1123743965 15:23303901-23303923 GCGTGGGCGCGGCCGCACCGGGG + Intergenic
1126746297 15:51829619-51829641 GCGTGCGCACTCCCGTGCCGCGG - Exonic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1131144369 15:90001746-90001768 GCCTGCGCGCGGCCGTCCCCAGG - Intronic
1132320280 15:100919895-100919917 GCGCGGGTGAGCCCGTGCCGGGG + Intronic
1132898011 16:2238055-2238077 GCCTGCGTGCGCCCGGGCGGTGG - Intronic
1132987738 16:2776872-2776894 GCCTGCGGGCGCCCGAGCCGCGG - Intronic
1136478531 16:30527257-30527279 GCGGGCGCGCGCAGGTGCCGGGG - Intronic
1136592225 16:31224420-31224442 GCGTGCAGGCGCCCGCGGCGGGG - Exonic
1136705992 16:32188324-32188346 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1136761920 16:32741081-32741103 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1136806180 16:33129307-33129329 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1142142085 16:88476991-88477013 ACGTGCGCACGCCCGTGCGCCGG + Intronic
1203064079 16_KI270728v1_random:1001397-1001419 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1142611074 17:1109405-1109427 GCGAGCGCGAGCCCGAGCCCCGG - Intronic
1142812361 17:2401228-2401250 GTGTGCGCGCGCCGGATCCGGGG - Intergenic
1146058599 17:29593221-29593243 GCGGGCGCGCGTCCCTGCGGCGG + Intronic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1152038470 17:77888065-77888087 GTGTGCGCGCACCCGTGCATGGG - Intergenic
1152356754 17:79811280-79811302 GCGTGCGCGTGCGCGCGCCTCGG - Intergenic
1152575499 17:81138952-81138974 GGGTGCGCGCGCACGTGTGGGGG - Intronic
1152651999 17:81499175-81499197 GCCCGCGCGTGCCCGTGCCTTGG - Intergenic
1153851878 18:9102653-9102675 GCGTGCGCGCTCCCGACCCCAGG - Exonic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1160452401 18:78974324-78974346 GCGTGCGCGTGCGCGTGCGAAGG - Intergenic
1160631214 18:80247435-80247457 GCGAGCGCGGGCCGGGGCCGGGG - Exonic
1160736204 19:663417-663439 GCGTGCGCGGGGCGGGGCCGAGG + Intergenic
1160767083 19:813420-813442 GCGGGCGCGCGCAGGTGCCCGGG + Exonic
1160867212 19:1261226-1261248 ACGTGAGCGTGCCCGTGCCGGGG - Intronic
1162485960 19:10960842-10960864 GCGCGTGCGCGCCCGTCCCTGGG - Intergenic
1163426979 19:17245432-17245454 GCGTGCGCGGGGCCGGGCCCGGG + Exonic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1163804126 19:19385918-19385940 GGGTGCGCGTGCGCGCGCCGGGG - Exonic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1167134516 19:47608967-47608989 CCGGGCCCGCGCCCGTTCCGGGG - Intronic
1168350974 19:55675331-55675353 TCGTGCGTGCGCCCGTGGCCCGG + Intronic
1168408019 19:56120860-56120882 GCGCGCGCGTGCGCGTGGCGGGG - Intronic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932790194 2:74648313-74648335 GCGTGCGCCCGCGCGTTCGGAGG + Intronic
933893203 2:86789612-86789634 GCGTGCGGGGGCCCGGGGCGGGG - Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
936102450 2:109594696-109594718 GCGTGCACGCGCCCGCACAGAGG - Intronic
937951033 2:127388055-127388077 GCGGGCGCGCGCCCGGCCCAGGG + Intronic
938397841 2:130963936-130963958 GGGCGCGCGAGCCCGGGCCGGGG - Intronic
946321957 2:218959703-218959725 CAGTCCGCGCGCCCGGGCCGGGG + Exonic
948995537 2:241576385-241576407 GGGTGCACGCGGCCGTGCCCAGG + Intergenic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1175429602 20:58891946-58891968 GGGAGCGCGCGCCCGGGGCGGGG - Intronic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1179988210 21:44932633-44932655 CCGTGCGGGCGCCAGCGCCGTGG + Intergenic
1180699660 22:17774399-17774421 GCGCGGGCGCGTCCGGGCCGAGG + Intronic
1181514369 22:23402677-23402699 GCGGGCGCGGGCCCGGGCTGGGG + Intergenic
1181937932 22:26451979-26452001 GCGCGCGCGCGCGCGTAACGTGG - Exonic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1182586300 22:31346023-31346045 GCAGGCGCGCGCGCGCGCCGCGG + Exonic
1183665014 22:39242197-39242219 GCGGGCGCGCGACCTGGCCGCGG + Intronic
1184362092 22:44024676-44024698 GCGTGCGGGCGCCTGCGCGGCGG + Intronic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
952948315 3:38496321-38496343 GCATGCGCGCGCATGCGCCGTGG + Exonic
953099208 3:39809346-39809368 GGCTGCGCGCGCCCGGGGCGGGG - Intronic
960269453 3:115658536-115658558 GCGGGCTCGCGGCCGTGCTGCGG + Intronic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
961540810 3:127598213-127598235 GCGTGCGCTCGCCTGCGCTGTGG - Exonic
962263113 3:133927527-133927549 GCGTGCGTGCGTGCGTGCGGTGG + Intergenic
962575620 3:136752493-136752515 GTTTGCGCGCGCCCCTGCCGCGG - Intergenic
968046254 3:195625179-195625201 GTGTGCGTGCGTCCGTGCCTGGG - Intergenic
968234803 3:197025186-197025208 GCGTGTGTGCGCCCGTGCGATGG - Intronic
968308398 3:197664908-197664930 GTGTGCGTGCGTCCGTGCCTGGG + Intergenic
970585602 4:17511758-17511780 GCGTGCGCACGCCAGTCCCAGGG - Intronic
979205542 4:118033555-118033577 GCCCGCGCGCGCCCGCCCCGGGG - Intergenic
984698225 4:182800129-182800151 GCGCGCGCTCGCCCGGGCCTGGG + Exonic
984811326 4:183798173-183798195 GGGTGCCCGCGTCCCTGCCGGGG + Intergenic
985629860 5:1008779-1008801 GAGCGCGTGCGCCCGCGCCGGGG - Intergenic
985747057 5:1653696-1653718 GTGTGCGTGCGTCCGTGCCTGGG + Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1015366367 6:132401529-132401551 GCGGGCGCGCGGCCGGCCCGAGG - Exonic
1016308013 6:142703479-142703501 GCGTGCGCGCGCATGTTGCGGGG - Intergenic
1019765119 7:2844221-2844243 GCGAGGGCGAGCCCGGGCCGAGG + Exonic
1022715172 7:32891929-32891951 GCGCGCGCGTTCCCGGGCCGCGG - Intronic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1029640228 7:101815799-101815821 GCGCGCGCGAGGCCGGGCCGCGG + Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032298845 7:130668518-130668540 GCGTGGGCGCCGCCGTGCCAGGG - Intronic
1035691000 8:1559797-1559819 GCGTGAGCTCCCCCGTGCCCAGG + Intronic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1040862017 8:52008667-52008689 AAGTGCGTGCGCCCGTGCCCAGG - Intergenic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1049212180 8:141391915-141391937 GCGGGCGCGCGGCCGCGGCGTGG + Intergenic
1049585496 8:143430785-143430807 GGGGGCGCGCGCCCCTCCCGGGG - Intergenic
1050472546 9:6008040-6008062 CCGTGCGCGCGCCGCCGCCGGGG - Intergenic
1051418816 9:16870817-16870839 GCCCGCGCGCGCCCTCGCCGCGG + Intronic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1057716620 9:97501438-97501460 GCGAGCGCGGGCCCCTGCCTGGG - Intronic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1058110738 9:101028868-101028890 TTGTGCGCGCGCCCGTGGGGCGG - Exonic
1058413817 9:104764310-104764332 GCGGGGGCGCGCCCGAGCCCTGG + Intronic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1061361192 9:130143345-130143367 GAGTGGGCGGGCCAGTGCCGAGG - Intergenic
1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG + Exonic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1189310604 X:40014818-40014840 GCGCGCGCGCGCTCGTGGAGCGG - Intergenic
1197774683 X:130111201-130111223 GGGAGCGCCCGCCCGGGCCGCGG - Intergenic
1199086454 X:143634724-143634746 GCGCGCGCGCACGCGAGCCGAGG - Intronic
1200173628 X:154097229-154097251 GCGGGCGCGCGACGGCGCCGCGG + Intronic
1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG + Intergenic