ID: 1069976287

View in Genome Browser
Species Human (GRCh38)
Location 10:72216008-72216030
Sequence GCGCACGCCGCCTTCGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 97}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069976286_1069976287 -8 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976285_1069976287 -5 Left 1069976285 10:72215990-72216012 CCACCACGGCACGGGCGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976271_1069976287 25 Left 1069976271 10:72215960-72215982 CCCCTCCTCGCGTCTCCGCCCCG 0: 1
1: 0
2: 3
3: 40
4: 503
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976275_1069976287 20 Left 1069976275 10:72215965-72215987 CCTCGCGTCTCCGCCCCGGCCAC 0: 1
1: 0
2: 1
3: 33
4: 301
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976283_1069976287 1 Left 1069976283 10:72215984-72216006 CCACGCCCACCACGGCACGGGCG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976274_1069976287 23 Left 1069976274 10:72215962-72215984 CCTCCTCGCGTCTCCGCCCCGGC 0: 1
1: 0
2: 1
3: 42
4: 285
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976280_1069976287 5 Left 1069976280 10:72215980-72216002 CCGGCCACGCCCACCACGGCACG 0: 1
1: 0
2: 1
3: 7
4: 158
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976276_1069976287 10 Left 1069976276 10:72215975-72215997 CCGCCCCGGCCACGCCCACCACG 0: 1
1: 0
2: 3
3: 52
4: 558
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976279_1069976287 6 Left 1069976279 10:72215979-72216001 CCCGGCCACGCCCACCACGGCAC 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976284_1069976287 -4 Left 1069976284 10:72215989-72216011 CCCACCACGGCACGGGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976278_1069976287 7 Left 1069976278 10:72215978-72216000 CCCCGGCCACGCCCACCACGGCA 0: 1
1: 1
2: 1
3: 23
4: 209
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97
1069976272_1069976287 24 Left 1069976272 10:72215961-72215983 CCCTCCTCGCGTCTCCGCCCCGG 0: 1
1: 0
2: 2
3: 19
4: 182
Right 1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069976287 Original CRISPR GCGCACGCCGCCTTCGCCGC TGG Exonic