ID: 1069976288 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:72216015-72216037 |
| Sequence | GACGGAGCCAGCGGCGAAGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 174 | |||
| Summary | {0: 1, 1: 1, 2: 1, 3: 20, 4: 151} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069976288_1069976298 | 13 | Left | 1069976288 | 10:72216015-72216037 | CCGCCTTCGCCGCTGGCTCCGTC | 0: 1 1: 1 2: 1 3: 20 4: 151 |
||
| Right | 1069976298 | 10:72216051-72216073 | ACACGCCGCGGTCCTCGTCGTGG | 0: 1 1: 0 2: 0 3: 2 4: 14 |
||||
| 1069976288_1069976297 | 1 | Left | 1069976288 | 10:72216015-72216037 | CCGCCTTCGCCGCTGGCTCCGTC | 0: 1 1: 1 2: 1 3: 20 4: 151 |
||
| Right | 1069976297 | 10:72216039-72216061 | GTTGGGGGGCGAACACGCCGCGG | 0: 1 1: 0 2: 0 3: 0 4: 30 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069976288 | Original CRISPR | GACGGAGCCAGCGGCGAAGG CGG (reversed) | Exonic | ||