ID: 1069976290

View in Genome Browser
Species Human (GRCh38)
Location 10:72216021-72216043
Sequence TCGCCGCTGGCTCCGTCTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069976284_1069976290 9 Left 1069976284 10:72215989-72216011 CCCACCACGGCACGGGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976279_1069976290 19 Left 1069976279 10:72215979-72216001 CCCGGCCACGCCCACCACGGCAC 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976285_1069976290 8 Left 1069976285 10:72215990-72216012 CCACCACGGCACGGGCGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976280_1069976290 18 Left 1069976280 10:72215980-72216002 CCGGCCACGCCCACCACGGCACG 0: 1
1: 0
2: 1
3: 7
4: 158
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976278_1069976290 20 Left 1069976278 10:72215978-72216000 CCCCGGCCACGCCCACCACGGCA 0: 1
1: 1
2: 1
3: 23
4: 209
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976276_1069976290 23 Left 1069976276 10:72215975-72215997 CCGCCCCGGCCACGCCCACCACG 0: 1
1: 0
2: 3
3: 52
4: 558
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976283_1069976290 14 Left 1069976283 10:72215984-72216006 CCACGCCCACCACGGCACGGGCG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1069976286_1069976290 5 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976290 10:72216021-72216043 TCGCCGCTGGCTCCGTCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069976290 Original CRISPR TCGCCGCTGGCTCCGTCTGT TGG Exonic