ID: 1069976297

View in Genome Browser
Species Human (GRCh38)
Location 10:72216039-72216061
Sequence GTTGGGGGGCGAACACGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069976286_1069976297 23 Left 1069976286 10:72215993-72216015 CCACGGCACGGGCGCGCGCACGC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
1069976293_1069976297 -8 Left 1069976293 10:72216024-72216046 CCGCTGGCTCCGTCTGTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 128
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
1069976288_1069976297 1 Left 1069976288 10:72216015-72216037 CCGCCTTCGCCGCTGGCTCCGTC 0: 1
1: 1
2: 1
3: 20
4: 151
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
1069976284_1069976297 27 Left 1069976284 10:72215989-72216011 CCCACCACGGCACGGGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
1069976289_1069976297 -2 Left 1069976289 10:72216018-72216040 CCTTCGCCGCTGGCTCCGTCTGT 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
1069976285_1069976297 26 Left 1069976285 10:72215990-72216012 CCACCACGGCACGGGCGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1069976297 10:72216039-72216061 GTTGGGGGGCGAACACGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069976297 Original CRISPR GTTGGGGGGCGAACACGCCG CGG Exonic