ID: 1069977979

View in Genome Browser
Species Human (GRCh38)
Location 10:72231082-72231104
Sequence GCAGAAATGAAGGCCTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 0, 2: 8, 3: 53, 4: 582}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069977979 Original CRISPR GCAGAAATGAAGGCCTGGTG AGG (reversed) Intronic
900312421 1:2040386-2040408 TCTGAAATGGAGGCCAGGTGTGG + Intergenic
900408737 1:2503571-2503593 GCAGAAAGGAAAGCTTGGTCAGG - Intronic
900530860 1:3152525-3152547 GAAGAAATGAAGGCTTGGAGGGG + Intronic
900820184 1:4880541-4880563 ACAGAAATCAGGGCCTGGTGAGG + Intergenic
901368417 1:8774642-8774664 GCCAAAATGATGGCCGGGTGTGG - Intronic
901382221 1:8882050-8882072 AAAGAAATGGAGGCCGGGTGCGG + Intergenic
901580746 1:10240852-10240874 TAAGAAATGAGGGCCAGGTGTGG - Intronic
901583457 1:10265552-10265574 ACACAAATTAAGGCCAGGTGCGG + Intronic
901697848 1:11022496-11022518 CCAGAACCGAAGGCCTGGTTTGG - Exonic
902147863 1:14418898-14418920 GCAGAAATGATGGCTGGATGGGG + Intergenic
902633692 1:17720798-17720820 GAAGAAACTAAGGCCTGGTATGG - Intergenic
903276685 1:22226354-22226376 GCAAGAATGAAGACCTGTTGGGG + Intergenic
903596581 1:24500105-24500127 CAAGAAATGGAGGCCGGGTGCGG + Intergenic
903682453 1:25106331-25106353 CCAGATATAAAGTCCTGGTGAGG + Intergenic
904092565 1:27955623-27955645 GTAGAAATGAGGGTCTGGAGAGG + Intronic
904782262 1:32959225-32959247 GCAGCAATGAAAGGCTGGAGTGG + Intronic
905279019 1:36837117-36837139 GCAGAGATGAGGACCTGGGGTGG - Intronic
905546111 1:38801689-38801711 GCAGAGAGGAGGCCCTGGTGTGG - Intergenic
908196774 1:61752614-61752636 AAAGAAATGAAGGCCAGGCGCGG - Intronic
909476589 1:76087651-76087673 GAGGAAATGAAGGCTTGGAGAGG + Intronic
909976287 1:82049381-82049403 GGAGAAAAAAAGGCCTGATGAGG - Intergenic
910353391 1:86325701-86325723 GCATAATTGAAGTTCTGGTGAGG + Intergenic
912188831 1:107314112-107314134 TAAAAAATGAAGGCCAGGTGTGG + Intronic
912329752 1:108807865-108807887 ACAGAAAAGAAGGCTGGGTGCGG - Intronic
912496753 1:110096777-110096799 GATGGAATAAAGGCCTGGTGGGG - Intergenic
912809121 1:112780458-112780480 TGAAAAATGAAGGCCTGGCGGGG + Intergenic
912969697 1:114269209-114269231 GAAGAAATTGAGGCCTGGAGTGG + Intergenic
912981272 1:114375347-114375369 GCAGCAAGAAAGGCCAGGTGCGG - Intergenic
914248624 1:145904046-145904068 GCAATAATGGTGGCCTGGTGAGG - Exonic
914374336 1:147060426-147060448 GCTGAAAAGAGGGCCCGGTGTGG - Intergenic
914476543 1:148028003-148028025 GCTGAAAAGAAGGCTGGGTGTGG + Intergenic
914842485 1:151259906-151259928 GAAGAAATGAGGGCCAAGTGTGG + Intronic
914883012 1:151562200-151562222 GCAGCAAGGAAGCACTGGTGTGG - Intronic
915099873 1:153491438-153491460 GTAGAAATGAAGACCTGGGGAGG - Intergenic
915560572 1:156684869-156684891 GGAGAACTAAAGGCCAGGTGGGG + Intergenic
915647667 1:157285492-157285514 GCAGAAATGAAGCCCTGCTATGG + Intergenic
916750667 1:167720594-167720616 GTAAAAATGAGGGCCGGGTGCGG - Intergenic
916981355 1:170140843-170140865 GTGAAAATTAAGGCCTGGTGAGG - Intergenic
917740274 1:177955203-177955225 AGAGAAATGCAGGCCCGGTGCGG + Intronic
917784370 1:178436970-178436992 ACAGAAAGGAAGGAATGGTGAGG - Intronic
917857961 1:179117123-179117145 ACAGAAGTATAGGCCTGGTGTGG - Intronic
918106683 1:181421436-181421458 GCAGATATGTGGACCTGGTGAGG - Intronic
918245548 1:182656466-182656488 ACAAAACTGATGGCCTGGTGGGG + Intronic
918635169 1:186765893-186765915 GGAGAAATGAAGGCCTGCAGAGG + Intergenic
920492572 1:206428634-206428656 GAAGAAATGAAGGCTTAGTGAGG - Intronic
921713493 1:218395902-218395924 AAAGAAATCAAGGCCTGGCGCGG - Intronic
922292101 1:224216858-224216880 TCAGACATGAAGGCCAGGCGCGG + Intergenic
923059124 1:230454246-230454268 ACAGAAAGTAAGGCCGGGTGCGG - Intergenic
923178514 1:231493038-231493060 GCAAAAGTGAAGGTCAGGTGTGG - Intergenic
923552603 1:234976073-234976095 GCAGAAATGGAGGCCAGGAAAGG + Intergenic
924584364 1:245348814-245348836 GCAGACATGAAGGACTGGGTGGG - Intronic
1064621748 10:17224535-17224557 GCAGAAAAGAAAGCATGGAGGGG + Intergenic
1064856313 10:19772294-19772316 GAAGAAATCAAGGCCGGGCGCGG + Intronic
1065262004 10:23933416-23933438 GAAGAAATAAAGGCTTGGAGAGG - Intronic
1065527623 10:26638743-26638765 GCACCTATCAAGGCCTGGTGTGG - Intergenic
1065536870 10:26723391-26723413 GAAGAAATCAATGCCTGGAGAGG - Intronic
1065850282 10:29782068-29782090 ACAGAAATTAAGGCCGGGTGCGG + Intergenic
1066174496 10:32889840-32889862 ACAGAAATAAGGGCTTGGTGAGG - Intergenic
1066382594 10:34913850-34913872 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1066981558 10:42421221-42421243 GCAGACATGCAGGCCCAGTGTGG + Intergenic
1067156387 10:43784494-43784516 GGAGACAGGAAGGCCAGGTGTGG + Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1068503235 10:57866297-57866319 GCAGAAATGTAGGCTTCCTGTGG + Intergenic
1069000921 10:63263639-63263661 ATACAAATGAAGGCCAGGTGTGG + Intronic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069480559 10:68777928-68777950 TCTGAAAAGAAGGCCGGGTGCGG + Intronic
1069614079 10:69795335-69795357 GCAAGAATGAATGCCTGGTAGGG - Intergenic
1069672507 10:70220218-70220240 GCATAATTGCAGGCCAGGTGCGG - Intronic
1069977979 10:72231082-72231104 GCAGAAATGAAGGCCTGGTGAGG - Intronic
1069982514 10:72262106-72262128 ACAAAAATAAAGGCCTGGTATGG - Intergenic
1070007064 10:72435098-72435120 GAAGAAATAAAGGCCAGGTATGG + Intronic
1070610802 10:77931108-77931130 ACAAAAATTAAGGCCAGGTGTGG - Intergenic
1072250577 10:93579127-93579149 GGAGAAGTGAAGGCCGGCTGTGG - Intronic
1073301506 10:102473774-102473796 GCAGGAATGAAGGCATGGGATGG - Intronic
1075253048 10:120899490-120899512 GGGGAAAAGAAGGCCGGGTGTGG + Intronic
1075398317 10:122143407-122143429 GCAGAAGTGGAGGCCTGGATGGG + Intronic
1075582576 10:123633510-123633532 AGAGAAATGAAGGCTTGGGGAGG + Intergenic
1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG + Intronic
1077301189 11:1847708-1847730 AAAAAAATGAAGGCCAGGTGTGG + Intergenic
1079374531 11:19880111-19880133 GCTGAAATGCAGTCCAGGTGGGG + Exonic
1080690376 11:34552405-34552427 GTATCAGTGAAGGCCTGGTGGGG - Intergenic
1081270320 11:41075493-41075515 GCAGGAAAGAAGGCCTTGAGTGG - Intronic
1082027058 11:47580236-47580258 GCAGAAATGCAGGCAATGTGAGG + Intronic
1082641139 11:55663064-55663086 GCAGAAATTGAGGACTGGGGAGG + Intergenic
1083018840 11:59485304-59485326 GCAGAAATGGAGGCTGGGTGCGG - Intergenic
1083227317 11:61293491-61293513 GCACAACTGCAGGCCTGGAGGGG + Intronic
1083423293 11:62568522-62568544 AAAGAAATGGAGGCCAGGTGTGG - Intronic
1083659275 11:64244809-64244831 CCAGAAATGAAGGCCTGGATGGG + Exonic
1083670967 11:64299747-64299769 GCAGAAACGAAGCCCTTGAGAGG - Exonic
1083884518 11:65565563-65565585 GAAGTGATGAAGGCCTGGAGGGG + Intergenic
1084121955 11:67074654-67074676 CCAGAAATGAAGCTGTGGTGGGG + Intergenic
1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG + Intronic
1084435085 11:69134820-69134842 GCTGAAAGAAAGGCCTGGTGAGG - Intergenic
1084749081 11:71192149-71192171 GATGAGATGAAGGCCGGGTGTGG - Intronic
1084901459 11:72313025-72313047 ACAGAAACAAAGGCCTGGGGTGG - Intronic
1085086247 11:73669524-73669546 ACAGAGATGGAGGCCGGGTGCGG + Intergenic
1085340183 11:75726227-75726249 GGGGCAATGAAGGCCTGGCGAGG + Intronic
1086386679 11:86316218-86316240 AAAGAAAAGAAGGCCGGGTGTGG + Intronic
1088085112 11:105968616-105968638 GCAGAAATGCATGACTTGTGGGG + Intronic
1088231018 11:107673291-107673313 TAAGAAATGAAGGCCAGGCGCGG + Intergenic
1088292755 11:108259197-108259219 GTGGAAATTAAGGCCAGGTGCGG + Intronic
1089005187 11:115084919-115084941 GCATAACGCAAGGCCTGGTGGGG - Intergenic
1089155341 11:116397751-116397773 GCAGAAACGAAGGCCAAGTTTGG - Intergenic
1089922650 11:122224826-122224848 GCAGAAGAGAAAGGCTGGTGAGG + Intergenic
1090024638 11:123157262-123157284 GAAGAAATGAGGGCGTGGCGTGG + Intronic
1090802741 11:130183248-130183270 TAAGAAATGTAGGCCGGGTGTGG - Intronic
1090924897 11:131240925-131240947 GCAGAAATGAAGGGGAGGAGAGG - Intergenic
1091096115 11:132823751-132823773 GCAGAGATGAAGGGATGATGGGG - Intronic
1091096194 11:132824582-132824604 GCAGAGATGAAGGGATGATGGGG - Intronic
1091478309 12:799419-799441 ACAGACATGCAGGCCGGGTGCGG - Intronic
1091847864 12:3671150-3671172 GCAGAAATGCAGGCCAGCAGAGG + Intronic
1092283963 12:7118123-7118145 TCAGAAAAGAAGGAGTGGTGGGG + Intergenic
1092326949 12:7542782-7542804 ACAGAACTGAAGGCCAGGTGAGG + Intergenic
1092482149 12:8869320-8869342 GCAGAACTCATGGCATGGTGTGG - Intronic
1092485708 12:8900613-8900635 GCTGAAATGAGGGCCGGGCGCGG - Intergenic
1092501441 12:9051327-9051349 GCAGAGAGGAAGCCCTGGAGGGG - Intergenic
1093452708 12:19333897-19333919 GAATAAATGAAGGCCAGGTGCGG - Intronic
1094042141 12:26129328-26129350 GCTAAAATCAAGGCCTGGAGGGG + Intronic
1094094143 12:26685092-26685114 GCAGAAAGGCAGGCATTGTGTGG - Intronic
1094421240 12:30273343-30273365 GCAAGAATGAAGGCCTTGTTTGG - Intergenic
1094797845 12:33997193-33997215 ATGGAAATGAAGGCCTGGGGTGG + Intergenic
1095154657 12:38837788-38837810 GCAGAATTGAAAACCTGATGAGG + Intronic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1095569625 12:43669597-43669619 GCAGAAATCAAGGTGTGGTCAGG - Intergenic
1096170795 12:49468021-49468043 GAAGAAAAGAAGGTCAGGTGTGG - Intronic
1096479370 12:51928123-51928145 AAAGAAATAAAGGCCGGGTGTGG + Intergenic
1096532826 12:52252708-52252730 GCAGAAATGCAGGTCCAGTGTGG - Intronic
1097152331 12:56988026-56988048 GCAGAGATGAAGGAATGTTGAGG + Intergenic
1098381887 12:69878756-69878778 GAGGAAATGGAGGCCTGGAGAGG + Intronic
1098690684 12:73483331-73483353 CAAGAAATGGAGGCCGGGTGTGG - Intergenic
1098910084 12:76199984-76200006 ACAGAAATGAAAGCCAGCTGTGG + Intergenic
1099847114 12:88041567-88041589 GCAGAAAATAAGTGCTGGTGAGG - Intronic
1100599543 12:96101069-96101091 GAAGAAAAGGAGGCCGGGTGCGG - Intergenic
1100811900 12:98346831-98346853 GCAAATATGTAGCCCTGGTGCGG + Intergenic
1101086294 12:101239716-101239738 GCAGAAAGGAGGCCCTGGAGAGG - Intergenic
1101404323 12:104414622-104414644 GCAGATCTGAACGCCTGGTGGGG - Intergenic
1101471802 12:105004278-105004300 GTAAAAATAAAGGCCAGGTGCGG + Intronic
1101866727 12:108525775-108525797 GAAGACATGGAGGCCTGGAGAGG - Intronic
1101884562 12:108650595-108650617 GAAGAACTTAAGGCTTGGTGAGG - Intronic
1102221310 12:111196570-111196592 GAAGAAATGAATGGCAGGTGGGG + Intronic
1102250071 12:111380776-111380798 GGGGAAATGAATGCCTGGTCAGG + Intergenic
1102273699 12:111562428-111562450 GAGAAAAAGAAGGCCTGGTGTGG + Intronic
1102394829 12:112576507-112576529 ACAAAAATTAAGGCCGGGTGAGG - Intronic
1104353606 12:128066279-128066301 TCAGAAAAGAAGGCCAGGTGAGG + Intergenic
1104761075 12:131297836-131297858 GCAGAAAGGCAGGCCTGGTGCGG + Intergenic
1104818702 12:131662956-131662978 GCAGAAAGGCAGGCCTGGTGCGG - Intergenic
1105584804 13:21734037-21734059 GAAGAAATGAAAGCCTGCAGAGG + Intergenic
1105758374 13:23490863-23490885 TCAAAAATGAGGGCTTGGTGGGG + Intergenic
1106768532 13:32940012-32940034 GAATGAATGAAGGCCTCGTGGGG + Intergenic
1107115081 13:36738263-36738285 GCAGAAATGAAGGCCCAGGCAGG + Intergenic
1107653307 13:42566701-42566723 GCATAAATAAAGGCCAGGCGTGG + Intronic
1107671464 13:42750481-42750503 GATGAAAAGAAGGCCTGGTAAGG - Intergenic
1109273119 13:60275853-60275875 CCAGAACCGAAGGCCTGGTTTGG - Intergenic
1110203198 13:72878037-72878059 GCAGAAATGAAGGCCGGGCATGG - Intronic
1110810703 13:79808150-79808172 GCAGAAAGGAGGCCCTGGAGTGG - Intergenic
1111111305 13:83713756-83713778 GCAGAAAGGATGCCCTGGTTAGG + Intergenic
1111512654 13:89287197-89287219 GCAGAGAGGAAGCCCTGGAGTGG + Intergenic
1113361748 13:109638215-109638237 GGAGAAATGAAGGCCAAGTTAGG + Intergenic
1113802380 13:113093288-113093310 ACACAGATGCAGGCCTGGTGTGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1115665373 14:35539460-35539482 GCAGACATGAAGGCCTGAAAGGG + Exonic
1116082485 14:40192726-40192748 AGAGAAATAAAGGCCAGGTGCGG + Intergenic
1117587290 14:57223045-57223067 GAAGAAATTGAGGCATGGTGGGG - Intronic
1118150937 14:63189749-63189771 GAACAAAAAAAGGCCTGGTGTGG - Intergenic
1118613455 14:67559292-67559314 GTAGAAATCAAGGACTGGGGAGG - Intronic
1119034356 14:71217161-71217183 GCAGAAGTGCAGGTGTGGTGTGG + Intergenic
1119253622 14:73179324-73179346 GCGGAAAAGAATGCCGGGTGTGG + Intronic
1119403316 14:74378986-74379008 ACAGAAAAAAAGGCCGGGTGCGG + Intergenic
1119613221 14:76081364-76081386 GCAAGAAAAAAGGCCTGGTGGGG - Intronic
1120982868 14:90306518-90306540 GCACTAATGTAGGCCGGGTGTGG + Intronic
1121734508 14:96208610-96208632 GCAGGAGTGAGGGCCTGGGGCGG + Intronic
1121785804 14:96660110-96660132 GCAGGAATGCAGGGCTGGGGAGG - Intergenic
1122485888 14:102079427-102079449 GAAAAAATTAAGGCCAGGTGTGG - Intergenic
1124343240 15:28903435-28903457 GCAGAAAGGGTGGCCTGCTGGGG + Intronic
1124510697 15:30322005-30322027 GCATAATTGAAGGCCAGGTGTGG - Intergenic
1124732191 15:32208530-32208552 GTATAATTGAAGGCCAGGTGTGG + Intergenic
1125068039 15:35515429-35515451 ACAAAAATTAAGGCCGGGTGCGG + Intronic
1125513740 15:40306737-40306759 AGGGAAATGAAGGCTTGGTGGGG - Intronic
1126795596 15:52258329-52258351 GCAGAAACTAAGGCTTGGAGAGG + Intronic
1127004515 15:54551198-54551220 ACAGAAATGAAGGTCTGTTATGG - Intronic
1127103595 15:55590282-55590304 AAAGAAATGAAGGCCAGCTGTGG + Intergenic
1127525885 15:59791857-59791879 GCAGAAAGGACGCCCTGGAGTGG + Intergenic
1128785333 15:70392620-70392642 GCAGAGATGAGGACATGGTGAGG + Intergenic
1128790664 15:70431541-70431563 GCAGAGAGGAAGCCCTGGAGGGG + Intergenic
1129199536 15:73990685-73990707 GCAGAGAATAAGGCCTTGTGAGG - Intronic
1129347557 15:74933121-74933143 TCAGAAAACAAGGCCAGGTGCGG + Intronic
1129416907 15:75388819-75388841 GGAAAAATGAAGCCCTGCTGGGG + Intronic
1129537743 15:76327914-76327936 GCAGGAATGCAGGCATGCTGTGG - Intergenic
1129706508 15:77797662-77797684 GCAGAAAGGAGGGGCTGGTCTGG - Intronic
1129820799 15:78600589-78600611 GTAAAAATAAAGGCCAGGTGCGG + Intronic
1130953036 15:88606845-88606867 GGAGAAATGAAGCCATGGGGTGG - Intergenic
1131897530 15:97049949-97049971 GGAGAAATGAAGGTTTGGGGAGG - Intergenic
1132428485 15:101741412-101741434 GAAGAAAAAAAGGCCGGGTGTGG + Intronic
1132581970 16:688917-688939 GCAGAAATTGAGGCTAGGTGTGG - Intronic
1132758395 16:1497008-1497030 ACAGAAAGGGAGGCCTGATGAGG - Intronic
1132850203 16:2021622-2021644 GCAGAGAAGCAGGCCGGGTGCGG - Intergenic
1133132899 16:3688772-3688794 CCCGAAATACAGGCCTGGTGTGG - Intronic
1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG + Intronic
1133556453 16:6910578-6910600 GAAGAAATGCAGCCCTGCTGAGG - Intronic
1133996447 16:10752172-10752194 GCAGAGACCAAGGCTTGGTGAGG + Intronic
1134222332 16:12364789-12364811 GCAGAAAAGATGGCCTGGCTTGG + Intronic
1134411977 16:14010714-14010736 TCAGAAATGAAGGCCAGGCATGG - Intergenic
1134662314 16:15993408-15993430 GAAGAAATCAAGGCCTGGTGAGG + Intronic
1135758474 16:25117561-25117583 TCACAAGTTAAGGCCTGGTGCGG + Intronic
1136604874 16:31326705-31326727 AAAGCAATGAAGGCCAGGTGCGG - Intronic
1136656464 16:31712207-31712229 GCTGGATTGAAGGCCAGGTGGGG + Intergenic
1136706332 16:32190940-32190962 AAAGAAATAAAGGCCAGGTGTGG + Intergenic
1136759385 16:32717652-32717674 GCAGAACAGAAGCCCTGTTGTGG + Intergenic
1136761577 16:32738477-32738499 AAAGAAATAAAGGCCAGGTGTGG - Intergenic
1136806525 16:33131913-33131935 AAAGAAATAAAGGCCAGGTGTGG + Intergenic
1139235769 16:65337329-65337351 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1139644736 16:68320112-68320134 GCAGAGATGTAGGCCAGGTTAGG + Intronic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140915547 16:79489915-79489937 GCAGTGATGAAGGCCTGAAGAGG + Intergenic
1140948315 16:79791973-79791995 GCAGAAATGGAGGCCTGGAGTGG - Intergenic
1141097371 16:81172379-81172401 GCACTAATGAGGGGCTGGTGAGG + Intergenic
1141736491 16:85857629-85857651 GCAGAAAGGAGGTCCTGGGGTGG + Intergenic
1141753992 16:85979153-85979175 GCAGAAATGAAAGCCCAGAGAGG - Intergenic
1141817804 16:86424950-86424972 GCAGGAATGTGGGCCTGGAGAGG - Intergenic
1142170525 16:88619769-88619791 GCAGAAGTCAAGGCGTGGTCAGG - Intronic
1203063732 16_KI270728v1_random:998792-998814 AAAGAAATAAAGGCCAGGTGTGG - Intergenic
1142826829 17:2518163-2518185 GCTGACATGGAGGCCAGGTGCGG - Intergenic
1143124023 17:4629832-4629854 TAAGAAATAAAGGCCGGGTGCGG + Intergenic
1143924098 17:10354440-10354462 ACAGAACTGAAGGCCTGCTTTGG + Intronic
1143924178 17:10355259-10355281 ACAGAACTGAAGGCCTGCTTTGG + Intronic
1144835635 17:18155286-18155308 GCAGAGATGAAGGGCGTGTGAGG - Intronic
1145218705 17:21071266-21071288 GAAGAAATCAAGACCTGGAGAGG + Intergenic
1146012576 17:29207592-29207614 CCAGAAAAGAAGGCCAGGTGTGG - Intergenic
1146793555 17:35766205-35766227 GAAGAAACAAAGGCCTGGGGAGG + Intronic
1147290794 17:39441479-39441501 ACAGAAAAAAAGGCCTCGTGCGG + Intronic
1147855381 17:43475816-43475838 GCCCAAATGAAGCCCAGGTGAGG + Intergenic
1148064777 17:44861148-44861170 GCATCAAAGAAGGCCGGGTGTGG + Intronic
1148191988 17:45685680-45685702 AAAGAACTGAAGGCCAGGTGCGG - Intergenic
1148598955 17:48879566-48879588 GTAGAAATGCAGGCTTGTTGAGG + Intergenic
1148855870 17:50579042-50579064 GGTGGAATGAAGGCCTGTTGGGG + Intronic
1149344548 17:55721190-55721212 GCAGAAATGAAAAGCTGGGGAGG + Intronic
1149505744 17:57192422-57192444 ACAGAAAAGAAGGACAGGTGTGG + Intergenic
1149694744 17:58607990-58608012 ACAGAAAAGAAGGCTGGGTGTGG + Intronic
1150671267 17:67200445-67200467 GACAAAAAGAAGGCCTGGTGTGG + Intronic
1150752169 17:67874350-67874372 GAGGAAATGATGGCCTGGAGAGG + Intronic
1150836152 17:68565809-68565831 GCAGTGATGGAGGCCTGGAGTGG - Intronic
1151447364 17:74175976-74175998 GCTGAAATGAAGTGCAGGTGTGG - Intergenic
1152346619 17:79756460-79756482 GCAGGAATGAGAGGCTGGTGAGG + Intergenic
1152668311 17:81585371-81585393 TAAGAAATCAAGGCCGGGTGTGG + Intronic
1152719404 17:81915520-81915542 GCAGAAAGGAAGGCAAGGTGAGG + Intronic
1153655060 18:7274824-7274846 GAAAAAATGCAGGCCAGGTGTGG - Intergenic
1154011798 18:10580636-10580658 GCAGATCTGAAGGCCTGGGCGGG - Intergenic
1155090241 18:22501949-22501971 ACAGAAAAGGAGGCCTGGTGTGG + Intergenic
1155120515 18:22814853-22814875 GGAGAACTAAAGACCTGGTGTGG - Intronic
1155240842 18:23862381-23862403 ACAGAAATGCAGGCCTCATGTGG + Intronic
1155345763 18:24855217-24855239 GCATAAATGAGGGACTGGGGAGG - Intergenic
1155774112 18:29737493-29737515 GCAGCAATGATGGCATGGTGTGG + Intergenic
1155870018 18:31015813-31015835 GGAGAAACCAAGGCTTGGTGGGG + Intronic
1156495111 18:37520392-37520414 GTAGAAATGAAGGCCCAGAGAGG + Intronic
1157421961 18:47555115-47555137 GGAAACAGGAAGGCCTGGTGGGG + Intergenic
1159087661 18:63812099-63812121 ATAGAAAGGATGGCCTGGTGTGG - Intergenic
1159550083 18:69885726-69885748 GCAGGTGTGAAGGCCTGGAGGGG - Intronic
1159598998 18:70410954-70410976 GAAGAAAAAAAGGCCAGGTGAGG + Intergenic
1159861882 18:73659499-73659521 TCACAAGTGAAGGACTGGTGGGG - Intergenic
1160248416 18:77179782-77179804 GCAGAAGGGGAGGCCTGCTGGGG + Intergenic
1160537351 18:79602069-79602091 GAAAAAAAGAAGGCCGGGTGCGG - Intergenic
1160709804 19:545931-545953 ACAGAAATTAAGGCCGGGTGCGG - Intronic
1160839567 19:1140007-1140029 GAAGAAATGCAGGCCGGGCGCGG + Intronic
1160899327 19:1419349-1419371 GCAGACCTGGAGGCCTGCTGAGG + Intronic
1160917098 19:1502193-1502215 GAAAAAATAAAGGCCGGGTGCGG - Intergenic
1161044121 19:2125710-2125732 ACAGAAATGTAGGCCGGGCGCGG + Intronic
1161154816 19:2727149-2727171 GCAGAAGTGATGGCCGGTTGCGG - Intronic
1161373880 19:3928953-3928975 ACAGAAAAGAAGGCCGGGCGCGG + Intergenic
1161547961 19:4893750-4893772 CCAAAAAGGAAGGCCGGGTGCGG + Intronic
1161636297 19:5391359-5391381 ACAGAAAGGAGGGCCAGGTGCGG - Intergenic
1161709401 19:5839347-5839369 GCAGAAATGCAGGCATGTTGAGG + Exonic
1161819951 19:6524006-6524028 GAATGAATGAAGGCCAGGTGCGG + Intergenic
1161968578 19:7562546-7562568 ACAAAAATTAAGGCCAGGTGTGG - Intergenic
1161995016 19:7706759-7706781 GCTGTCATGAAGGTCTGGTGGGG - Intergenic
1162513625 19:11135075-11135097 TAAGAAATGAAAGCCGGGTGTGG + Intronic
1162644557 19:12039362-12039384 GTAGAAATGAAGGCCGGGCATGG - Intronic
1162836868 19:13325430-13325452 GCAATAATACAGGCCTGGTGCGG - Intronic
1163003991 19:14386064-14386086 GTAAAAATGAAGGCGTGGTCAGG - Intronic
1163162219 19:15471555-15471577 ACAGACAAGGAGGCCTGGTGCGG - Intronic
1163420469 19:17211269-17211291 TCAGAAATAAAGGCCGAGTGCGG - Intronic
1163490321 19:17613998-17614020 ACAAAAAAGAAGGCCAGGTGCGG - Intronic
1164284484 19:23800900-23800922 GTAGAAATCTAGGCCAGGTGAGG - Intronic
1164927994 19:32145616-32145638 GGAGAAATTAAGGCCTTATGGGG - Intergenic
1165245657 19:34497151-34497173 TCAGAAAAGAAGGCCTGGTGTGG - Intronic
1165769795 19:38372861-38372883 ACAAAAATGATGGCCGGGTGTGG - Intergenic
1166011480 19:39945932-39945954 ACAAAAATTAAGGCCAGGTGCGG - Intergenic
1166046095 19:40232064-40232086 GCAGCACTGAGGGCCTGGAGTGG + Exonic
1167227218 19:48254460-48254482 AAAGAAATGCAGGCCTGGTGCGG + Intronic
1167347241 19:48954363-48954385 ACAGAAAAGCAGGCCTGGCGCGG + Intergenic
1168133705 19:54337146-54337168 GGAGAAAAGAAGGACGGGTGAGG + Intronic
1168209707 19:54881579-54881601 GCATGAATGAAGGCCGGGCGCGG + Intronic
1168303461 19:55420038-55420060 GCAGAGAGGAGGCCCTGGTGGGG - Intergenic
1168558202 19:57361431-57361453 ATAAAAATGAAGGCCGGGTGCGG - Intergenic
924963912 2:58186-58208 GCAGAAAGGAAGCCCTGAAGAGG - Intergenic
925764079 2:7214194-7214216 GGAGAACAGAAGGCTTGGTGGGG + Intergenic
925922699 2:8647843-8647865 GCAGAAAGGAGGCCCTGGAGAGG - Intergenic
925932366 2:8719304-8719326 TAAGAAATGAGGGCCGGGTGTGG + Intergenic
926191648 2:10732680-10732702 AAAGAAATGAAGGCCAGGCGCGG + Intronic
926283211 2:11466718-11466740 GAATAAATGAAGGCTGGGTGTGG - Intergenic
927254410 2:21027601-21027623 ATAGAAATGCAGGCCTGGCGAGG - Intronic
927430140 2:23020566-23020588 CCAGAAAACAAGGCTTGGTGTGG - Intergenic
927853367 2:26513509-26513531 GGTGAAATGAAGGCCTGCTGGGG - Intronic
928329316 2:30345746-30345768 AAAGCAATGAAGGCCAGGTGCGG + Intergenic
928586953 2:32769549-32769571 GCAGAAATGAAAGACTCCTGTGG + Intronic
928780101 2:34807609-34807631 ACAGAAAGCAAGGCCTTGTGAGG - Intergenic
929353074 2:40984095-40984117 GAAGAAATCAAGGCCGGGTGTGG - Intergenic
930665116 2:54094197-54094219 GCAGAGAAGAAGACATGGTGGGG + Intronic
932034616 2:68230281-68230303 ACAGAAATGAAGGCCGGGCATGG - Intronic
932128775 2:69168878-69168900 GCAGAAGTGAAGGCCTCCAGGGG - Intronic
934960206 2:98666400-98666422 TCAGAATTTAAGGCCGGGTGTGG + Intronic
934992744 2:98933032-98933054 GTAGAAATGGAGGCCTAGTACGG + Intronic
935127193 2:100235119-100235141 AAACAAACGAAGGCCTGGTGAGG + Intergenic
935331736 2:101982350-101982372 GCAGAAATGCAGGTTTGGGGAGG + Intergenic
936445963 2:112595495-112595517 ACAAAAATGAAGGCAGGGTGTGG - Intergenic
936698693 2:114983837-114983859 GCAGAAACTGAGGCCTGGAGAGG + Intronic
936997641 2:118432302-118432324 TCAGTAATGAAACCCTGGTGTGG - Intergenic
937132345 2:119523263-119523285 GCAGAAAGGAAGGAATGGGGAGG - Intronic
937268593 2:120632985-120633007 GCTGCAGAGAAGGCCTGGTGGGG + Intergenic
937803283 2:126105900-126105922 GCAGGAATGGAGGCATGGTTTGG - Intergenic
937976600 2:127586263-127586285 GAAGAAGTGAAGGCCTGGGGTGG + Intronic
938761590 2:134431071-134431093 CCAGATGTGAAGGCCTGGAGGGG + Intronic
940076933 2:149751957-149751979 ACAGACATGTAGGCCAGGTGTGG - Intergenic
940222881 2:151371883-151371905 GAAGAAAACAAGGCCAGGTGCGG - Intronic
941276223 2:163494104-163494126 GCAGGAATGATAGCCTGGAGTGG - Intergenic
941466926 2:165838850-165838872 GCAGAAAGCAAAGCCAGGTGTGG - Intergenic
942905123 2:181171409-181171431 GCACAAATGAAGGTCTAGAGAGG + Intergenic
943046587 2:182867552-182867574 GCAGAAAGTCAGACCTGGTGGGG + Intergenic
943526318 2:189021146-189021168 GCAGAGAAGAAGCCCTGGAGAGG - Intergenic
944029665 2:195219510-195219532 TAAGAATTTAAGGCCTGGTGTGG - Intergenic
944062564 2:195584535-195584557 TTAGAAATTAAGGCCAGGTGTGG + Intronic
944247825 2:197549839-197549861 TTAGAAATTAAGGCCAGGTGTGG - Intronic
944882591 2:204028592-204028614 GCAAAAATGCTGGCCTGGTGTGG - Intergenic
945097908 2:206237048-206237070 ACAAAAATTAAGGCCAGGTGTGG + Intergenic
945620745 2:212133672-212133694 ACATAAAGGAAGGCCAGGTGTGG + Intronic
945956354 2:216089742-216089764 GAAGAAGTCAAGGCCAGGTGTGG - Intronic
946027338 2:216679723-216679745 CCAGAAATGTAGGCCCGGAGGGG + Intronic
946237974 2:218336769-218336791 AAAGAATTGAAGGCCAGGTGTGG - Intronic
946465524 2:219908710-219908732 GATCAAATTAAGGCCTGGTGAGG + Intergenic
947511364 2:230757385-230757407 ACAGAAATACAGGCCAGGTGAGG - Intronic
947532744 2:230923176-230923198 GAAGAAAGGTAGGTCTGGTGTGG - Intronic
947924749 2:233911501-233911523 CCAGAAAAGAGGACCTGGTGGGG - Intergenic
948317758 2:237042220-237042242 GCAGAGATGAGGGCCAGGTCTGG - Intergenic
948477981 2:238232807-238232829 CCAGAACCGAAGGCCTGGTTTGG - Intergenic
1169167319 20:3435337-3435359 GTAGAAAAGAGGGCCAGGTGAGG - Intergenic
1169248445 20:4042216-4042238 GCAGAAATAAAGGACTAGGGAGG - Intergenic
1169479250 20:5962662-5962684 TAAGAAATGAAGGCCGGGCGCGG - Intronic
1169683087 20:8238893-8238915 GCAGAAGCTAAGGCCTGGGGAGG + Intronic
1169684561 20:8256480-8256502 GAAGAATTGAAGGCATGTTGAGG + Intronic
1170879492 20:20283564-20283586 TCAGAAATGCAGGCAAGGTGTGG + Intronic
1171197521 20:23211687-23211709 TCAGATGTGAAGTCCTGGTGTGG - Intergenic
1171199754 20:23231608-23231630 GCAGAAATGGAGGTCTTGGGGGG + Intergenic
1171205009 20:23272357-23272379 GCAGAAATGCAGCCATGCTGTGG - Intergenic
1171497841 20:25569698-25569720 GCAGAAGGCATGGCCTGGTGTGG + Intronic
1171816338 20:29788891-29788913 TCAGAAGTCAAGGCCGGGTGCGG + Intergenic
1172137412 20:32696499-32696521 GAAGAAATCCAGGCCAGGTGTGG - Intergenic
1172302476 20:33859893-33859915 GCAGCAGGGAAGGCCTGGGGAGG - Intergenic
1174120635 20:48262607-48262629 GCGGAAATGGAAGCCTGGGGAGG - Intergenic
1174275480 20:49400692-49400714 GCAGAATTGAAGCACTGCTGTGG + Intronic
1175059344 20:56227657-56227679 GTAGAAATGAGAGCCTTGTGAGG + Intergenic
1175086111 20:56460563-56460585 GCAGACAGGAAGGCGTGGTGTGG + Intergenic
1175087940 20:56476787-56476809 ACAGAAAACAAGGCCGGGTGTGG - Intronic
1175123654 20:56735880-56735902 GCAGGGATGAAGGGATGGTGGGG - Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175563715 20:59955181-59955203 GCAGAAATCCAAGCCGGGTGGGG + Intergenic
1177227744 21:18279622-18279644 AGAGAAATGAGGGCCGGGTGCGG - Intronic
1178039218 21:28620959-28620981 GAAGAAAAGAGGGCCAGGTGCGG - Intergenic
1178208401 21:30497656-30497678 GATGAAATGAAGGCTGGGTGAGG - Intergenic
1178216856 21:30608285-30608307 GCAGCAAGAAAGGCCAGGTGTGG - Intergenic
1179162333 21:38908858-38908880 GCAGAAAGGGAGGCTTGGGGAGG + Intergenic
1179631416 21:42680764-42680786 GCGGGAATGGAGGCCTGGGGAGG - Intronic
1179769937 21:43606994-43607016 ACAGAACTGGAGGCCAGGTGTGG + Intronic
1179915674 21:44476653-44476675 ACAGAGATGAAGGCAAGGTGAGG + Intergenic
1179927515 21:44544717-44544739 GGGGACATGATGGCCTGGTGGGG + Intronic
1180089406 21:45526092-45526114 GGAGAGATGGGGGCCTGGTGGGG - Intronic
1180319779 22:11309409-11309431 TCAGAAGTAAAGGCCGGGTGCGG + Intergenic
1180757752 22:18174518-18174540 GCATATAAGAAGGCCAGGTGTGG - Intronic
1180768031 22:18358314-18358336 GCATATAAGAAGGCCGGGTGTGG - Intergenic
1180778274 22:18504073-18504095 GCATATAAGAAGGCCGGGTGTGG + Intergenic
1180810999 22:18761383-18761405 GCATATAAGAAGGCCGGGTGTGG + Intergenic
1180953415 22:19730908-19730930 GGAGAAACGAAGGCCTGGAGCGG + Intergenic
1181101611 22:20544373-20544395 ACAGAAATTTAGGCCGGGTGCGG + Intronic
1181175361 22:21032067-21032089 GCAGCAAAGGAGGCCTGGTGAGG + Intronic
1181197149 22:21195636-21195658 GCATATAAGAAGGCCGGGTGTGG + Intergenic
1181916131 22:26281666-26281688 AAAGAAAAGAAGGCCAGGTGCGG - Intronic
1182060856 22:27396191-27396213 GCAGAAACCAAGGCCCAGTGAGG - Intergenic
1182108125 22:27703902-27703924 GCAGAAGAGAAGGCCGTGTGGGG - Intergenic
1182811606 22:33121649-33121671 GCAGAAATTTGGGCCTTGTGGGG + Intergenic
1182953003 22:34395365-34395387 GCAGAAATGAAGTCATTGAGGGG - Intergenic
1183219821 22:36505476-36505498 ATAGAATTGAAGGCCGGGTGCGG + Intronic
1183475285 22:38032824-38032846 GCAGTTATGAAGGCCTGCAGGGG + Intronic
1183896826 22:40976067-40976089 GAAGAAGTGAGGGCCGGGTGCGG - Intergenic
1184192313 22:42903084-42903106 GCTGCAGTGAAGGCCCGGTGAGG - Intronic
1184495411 22:44838424-44838446 GCAAAAATTAAGGCCGGGTACGG - Intronic
1184690531 22:46115326-46115348 GCAGAGCTCAAGGCCTGGTCGGG + Intergenic
1184776005 22:46623252-46623274 CAAGAAGTGGAGGCCTGGTGGGG - Intronic
1184868889 22:47220380-47220402 AAAGGAATGAAGGCCTGGAGGGG - Intergenic
1185263424 22:49884399-49884421 GCAGAGAAGAAGCCCTGGTGGGG + Exonic
1203229650 22_KI270731v1_random:99199-99221 GCATATAAGAAGGCCGGGTGTGG - Intergenic
949996977 3:9625788-9625810 AGAGAAATGAAGGCTGGGTGTGG - Intergenic
950032313 3:9861230-9861252 GCACAAAACAAGGTCTGGTGGGG - Intergenic
950335002 3:12186651-12186673 GCTAAAATGAAGCCCTGGTGGGG + Intronic
952771015 3:37000437-37000459 TAAGAAATTAAGGCCAGGTGTGG + Intronic
953714481 3:45306139-45306161 GCAGAGATGAAGGCTGAGTGGGG - Intergenic
953948312 3:47167376-47167398 GAAGAAATGTAGACCGGGTGCGG + Intergenic
954099322 3:48357417-48357439 GCAGAAAGGAGGCCCTGGTATGG + Intergenic
954118391 3:48479879-48479901 GTGGAAATGTAGGCCAGGTGTGG - Intronic
954166171 3:48760065-48760087 ACAAAAATGTAGGCCAGGTGTGG + Intronic
954238049 3:49272096-49272118 GAGGAAAGGGAGGCCTGGTGAGG - Intronic
954631225 3:52048642-52048664 GCTGAAATCAAGGCTTGGAGAGG - Intergenic
955182417 3:56683972-56683994 GAACAAATGGAGGCCAGGTGCGG - Intergenic
955755017 3:62217727-62217749 GCCCAAATGAAGCCCTGGTTGGG - Intronic
955798973 3:62666907-62666929 GCAGAAACTGAGGCATGGTGAGG - Intronic
956099099 3:65748789-65748811 GTCAAAATCAAGGCCTGGTGGGG + Intronic
956847046 3:73193236-73193258 GCAGAAAGGTAGGGCTAGTGGGG - Intergenic
956856427 3:73279697-73279719 GGATGAATGCAGGCCTGGTGTGG - Intergenic
957625873 3:82651122-82651144 GCAGAGATGAGGCCCTGGAGTGG - Intergenic
958572916 3:95911418-95911440 GCAGAAAGGAGGCCCTGGAGTGG + Intergenic
958636288 3:96750807-96750829 GCAGAGAGGAAGCCCTGGAGAGG - Intergenic
958955443 3:100461019-100461041 GCAGAAGTGACGGCCGGGCGCGG - Intergenic
959535343 3:107478731-107478753 GAAGATATAAAGGCCGGGTGGGG + Intergenic
960888373 3:122419594-122419616 TTAGAAATGAAGGCCGGGCGCGG + Intergenic
961048567 3:123726686-123726708 GCAGTAATGATGCCCTTGTGTGG + Intronic
961098087 3:124174920-124174942 GCAGAATTTAAGTCCTAGTGGGG + Intronic
961481084 3:127181179-127181201 GCAGAAAGGTAGGCCTGGAGGGG + Intergenic
961524430 3:127487597-127487619 GCAGAGGTGAAGGAGTGGTGTGG - Intergenic
961791136 3:129377811-129377833 GCAGAGAGGAAGCCCTGGAGTGG + Intergenic
962217311 3:133533817-133533839 GCAGAAATGATGGCTGTGTGTGG - Intergenic
962807761 3:138939075-138939097 GCAGAGATAAAGGCCGGGTCAGG - Intergenic
964031306 3:152142498-152142520 GAATAAATGATGGCCAGGTGTGG + Intergenic
964283492 3:155092530-155092552 GCTGTAATGAAGTCCTTGTGAGG - Intronic
964347473 3:155769020-155769042 ACAAAAATTAAGGCCAGGTGTGG + Intronic
966491530 3:180532388-180532410 GCAGATATGAGGCCCTGGAGAGG - Intergenic
967341941 3:188408076-188408098 ACATAAATGAGGGCCAGGTGCGG - Intronic
967461289 3:189749831-189749853 AAAGGAATGAAGGCCAGGTGCGG + Intronic
967522115 3:190444518-190444540 ATAGAAATGAGAGCCTGGTGAGG + Intronic
967876665 3:194272335-194272357 GGAGAAATGAAGGCCAGGGAGGG + Intergenic
968054992 3:195684371-195684393 GCAGAAATGGAGGCAGGGTTGGG + Intergenic
968100920 3:195964905-195964927 GCAGAAATGGAGGCGGGGTTGGG - Intergenic
968604135 4:1523618-1523640 GCAGAAGTGAAGGGCTTGTCTGG - Intergenic
969364915 4:6688794-6688816 GCAGAAATGAAGGCGTCATCAGG - Intergenic
969887137 4:10225082-10225104 GCAGAACTGACGGCCTAGTAAGG - Intergenic
970016929 4:11522111-11522133 CCAGAAATTAAGGGCAGGTGTGG - Intergenic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975527766 4:75369778-75369800 GATGAAATGAAGGCCTGCTGAGG - Intergenic
976316986 4:83669029-83669051 ATACAAATGAAGGCCGGGTGTGG + Intergenic
976818668 4:89179810-89179832 ACAGAAATGGAGGCCTGGGATGG - Intergenic
977976473 4:103272498-103272520 GCAGAAATGAAGGTTAGGTATGG - Intergenic
978692921 4:111537887-111537909 GCAGAAATGGTGGCATGGTAAGG - Intergenic
979145423 4:117240312-117240334 GCAGAAAGGAGGCCCTGGAGAGG - Intergenic
979288486 4:118953965-118953987 GCAGAAATCATGGCCTTCTGGGG - Intronic
979579242 4:122336524-122336546 GAAGAAACTAAGTCCTGGTGAGG + Intronic
980904184 4:138931740-138931762 GCAGTCATGAGGGCCAGGTGTGG - Intergenic
980908511 4:138972667-138972689 CCAGAAATGGAGGCCAAGTGTGG - Intergenic
982396486 4:154920687-154920709 GCAGTAATGAGGGTCAGGTGTGG + Intergenic
982874404 4:160627140-160627162 TCAGACATGGGGGCCTGGTGGGG + Intergenic
983491934 4:168398824-168398846 GCAGAGATGAGGCCCTGGAGTGG - Intronic
984427836 4:179610548-179610570 GCAGAACTGTAGGTCTGGAGGGG + Intergenic
984607732 4:181804717-181804739 TCAGAAGTGGATGCCTGGTGTGG + Intergenic
985011693 4:185588903-185588925 GAAGAAAAAAAGGCCGGGTGCGG - Intronic
985303365 4:188513115-188513137 GTAGAAAACAAGGCCGGGTGCGG + Intergenic
985661536 5:1159526-1159548 GCAGAATTTAAGACCTGGAGAGG - Intergenic
986384161 5:7215517-7215539 GCAGAAAGGTAGGCATCGTGTGG - Intergenic
986888122 5:12265788-12265810 TCAGAAATGAGGGCCAGGTTAGG - Intergenic
987075701 5:14380083-14380105 CCAGAAATGGAGGCCTGGGCTGG - Intronic
987964765 5:24857146-24857168 GTAGAAATGATGACCAGGTGTGG - Intergenic
988446089 5:31287549-31287571 GAGGAAATAAAGGCCTGGAGAGG + Intronic
989169362 5:38459577-38459599 GCTGAAATGAAGGTCTGGTTGGG + Intronic
989577763 5:43004554-43004576 GAAGAAGAAAAGGCCTGGTGAGG + Intergenic
989645902 5:43632338-43632360 GCTGGACTGAAGGCCTGGTGTGG + Intronic
989698687 5:44236124-44236146 GCAGAGCAGACGGCCTGGTGTGG + Intergenic
990250263 5:53906877-53906899 GCAGATGGGAAGGACTGGTGTGG - Intronic
990307896 5:54510920-54510942 GCAGAAATGCTGGCCCTGTGTGG + Intergenic
990793645 5:59514393-59514415 TGAAAAATGAAGGCCGGGTGCGG - Intronic
991483816 5:67113021-67113043 ACAGGGATGAAGGCCAGGTGTGG + Intronic
992000563 5:72432223-72432245 GTAGAAATACAGGCCAGGTGCGG - Intergenic
992060158 5:73036134-73036156 TCAGCACTTAAGGCCTGGTGTGG - Intronic
992397599 5:76382048-76382070 AGAGACAGGAAGGCCTGGTGTGG - Intergenic
992643327 5:78788920-78788942 ACAAAAATGTAGGCCAGGTGTGG - Intronic
992927167 5:81600270-81600292 TCAGAAAATAAGGCCGGGTGTGG + Intronic
995642087 5:114268445-114268467 GCAGAAATAAAAGTCTAGTGAGG - Intergenic
995893824 5:116987552-116987574 AGAGAAATGAGGGCCGGGTGTGG + Intergenic
996441184 5:123492682-123492704 GCAGAAAAGGAGACCAGGTGCGG + Intergenic
996923802 5:128799797-128799819 GCAGAGAGGAAGCCCTGGAGGGG + Intronic
997460460 5:134048256-134048278 GAAAAAAAAAAGGCCTGGTGCGG - Intergenic
997512553 5:134463526-134463548 GCAAAAATCAAGGCTTGGAGAGG - Intergenic
997541696 5:134668433-134668455 ACAGAAATTAAGGCCAGGTGCGG + Intronic
997641592 5:135452153-135452175 GGAGAAGGGAGGGCCTGGTGGGG - Intronic
999173019 5:149611338-149611360 GTAGAAATGAGGGTCTGTTGTGG + Intronic
999207637 5:149861306-149861328 GCAAAAATGATAGACTGGTGTGG + Intronic
1001752747 5:174144076-174144098 GAGGAAATGGAGGCATGGTGAGG + Intronic
1002042204 5:176522660-176522682 ACAAAAATGAAGGCCGGGCGTGG - Intergenic
1002505297 5:179675212-179675234 GGAGAGATGAGGGCCAGGTGTGG - Intergenic
1002789104 6:424778-424800 GCAGAAAGGAAGGCCCGGCGGGG - Intergenic
1003146362 6:3513548-3513570 GCAGAAAGAAAGTGCTGGTGGGG + Intergenic
1003384215 6:5652529-5652551 GCAGAAATGAAGGCCCAGTGCGG + Intronic
1003476321 6:6487248-6487270 GGAGAGATGAAGGCCCGGCGAGG - Intergenic
1003543038 6:7034912-7034934 GCAAAAATGAAGGCTGGGTGCGG + Intergenic
1003697888 6:8430587-8430609 AAAAAAATGAAGGCCAGGTGTGG + Intronic
1004084230 6:12428842-12428864 GAAGAAATTATGGCCTGGTGCGG - Intergenic
1004292321 6:14379440-14379462 GGTGAAATGAAGGCTAGGTGAGG + Intergenic
1004626814 6:17384722-17384744 GAAGGAAGGAAGGCCAGGTGTGG + Intergenic
1005416660 6:25606990-25607012 GCACAAAATAAGGCCAGGTGTGG + Intronic
1005428006 6:25724131-25724153 GAAGAAATCAAGGCTGGGTGCGG + Intergenic
1005950864 6:30630338-30630360 ACAGAAAAAAAGGCCAGGTGCGG + Intronic
1006133774 6:31883681-31883703 GCTGAAAGGGAGCCCTGGTGTGG - Intronic
1006622515 6:35375841-35375863 ACAGAAATAAAGGCCAGGTAAGG - Intronic
1006654825 6:35582030-35582052 GTAGAAAGGAAGCCCTGGTGTGG + Intronic
1006779100 6:36619963-36619985 ACAAAAATTAAGGCCAGGTGTGG + Intergenic
1007216958 6:40247844-40247866 GCAGAAATAAAGCCATGGAGTGG - Intergenic
1007409825 6:41655061-41655083 CCAGGAATGAAGGCTTGGAGTGG + Intergenic
1007466645 6:42056894-42056916 GAAGAAATCCAGGCCGGGTGCGG - Intronic
1007671331 6:43556836-43556858 AAAGAAATGAAGGCCGGGTGTGG + Intronic
1007700169 6:43761760-43761782 CTGGAATTGAAGGCCTGGTGAGG + Intergenic
1009350215 6:62666441-62666463 GAACAAGAGAAGGCCTGGTGCGG + Intergenic
1009533141 6:64845947-64845969 ATAAAAATGAAGGCCTGGTCTGG - Intronic
1009942158 6:70302496-70302518 GTAAAAATGAAGGCTGGGTGCGG - Intronic
1010188315 6:73167508-73167530 GCAGAAATTAAGGCTTGGAGAGG - Intronic
1010236381 6:73578354-73578376 ATGGAAATGAAGGCCAGGTGAGG + Intergenic
1010966697 6:82218061-82218083 TCAGAAATGAAGACCTGACGTGG + Exonic
1011286340 6:85728269-85728291 AAAGAAATCAGGGCCTGGTGTGG + Intergenic
1011429265 6:87267887-87267909 GTAGAAATGACGGCTGGGTGTGG - Intergenic
1011530113 6:88312333-88312355 GCAGAAAGGAGGCCCTGGAGTGG + Intergenic
1011771482 6:90678276-90678298 GCAGAGAGGAAGGCCTGGCAAGG + Intergenic
1012272425 6:97230393-97230415 GCAAAACTTAAGGCCAGGTGTGG - Intronic
1012603833 6:101132430-101132452 GAAAACATGAAGACCTGGTGTGG - Intergenic
1012867482 6:104635215-104635237 GCATAAAAGAAGGAATGGTGAGG - Intergenic
1012885055 6:104836420-104836442 AAAGAAATAAAGGCCTGGCGCGG + Intronic
1013082308 6:106823388-106823410 GGAGAAATGAGGCCCTAGTGAGG - Intergenic
1013086335 6:106861119-106861141 GCAGAAAGGAGGCCCTGGAGAGG + Intergenic
1013209988 6:107978105-107978127 GCGGAAACTTAGGCCTGGTGTGG + Intergenic
1016616571 6:146055617-146055639 ACAGAATTGAAGGGCTGGGGAGG + Intronic
1016704208 6:147088144-147088166 GCAGAAAGGAAGGCTTTGTGGGG + Intergenic
1017472500 6:154753173-154753195 ACAAAAATTAAGGCCCGGTGTGG + Intronic
1017629082 6:156378863-156378885 GCAGAACTGAAGACCTTCTGAGG + Intergenic
1017711142 6:157169249-157169271 GCACAAATGATGGCCAGGTCTGG + Intronic
1018064923 6:160118253-160118275 GCAGAGAGGAAGCCCTGGAGAGG + Intergenic
1021979564 7:26041086-26041108 GAAGAGAAGAAGGCCGGGTGTGG + Intergenic
1022797334 7:33742574-33742596 GCAGCAGCGATGGCCTGGTGGGG + Intergenic
1023537016 7:41224499-41224521 GCAGAAATTAGGCCCTGGTGAGG + Intergenic
1023655636 7:42417628-42417650 GCAAAAAAGAAGGCTTAGTGAGG + Intergenic
1023708421 7:42966200-42966222 TGAAAAATGAAGGCCAGGTGTGG - Intergenic
1023769242 7:43539916-43539938 CCAGGAATGAAGCACTGGTGGGG + Intronic
1024387087 7:48764559-48764581 GCAAAAATGAAGGTTTTGTGGGG + Intergenic
1025059681 7:55794939-55794961 GTAGAAAATAAGGCCAGGTGTGG - Exonic
1026655279 7:72251158-72251180 GCAGAATTGAAGGGCTGATTAGG - Intronic
1026945275 7:74312319-74312341 GCAGAGAAGAGGCCCTGGTGGGG + Intronic
1026985064 7:74549743-74549765 ACAAAAATTAAGGCCGGGTGCGG + Intronic
1028972028 7:96870101-96870123 GGAAAAATAAAGGTCTGGTGAGG + Intergenic
1029239599 7:99150087-99150109 ACAGAAACAAAGGCCTGGTGCGG - Intergenic
1029413327 7:100428874-100428896 GCGGAGAGGAAGGCGTGGTGTGG + Intronic
1030022587 7:105290746-105290768 GAAGAAATGAAGGCCGGGCGCGG + Intronic
1030201013 7:106904049-106904071 TCAGAAAAGTGGGCCTGGTGCGG - Intronic
1030782155 7:113614769-113614791 GCTAGAATGAAGGCCGGGTGCGG + Intergenic
1031132340 7:117847243-117847265 GCAGAAAACTAGGCCGGGTGTGG + Intronic
1033038241 7:137894939-137894961 GGAGAAACTGAGGCCTGGTGGGG - Intronic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1034012934 7:147549797-147549819 GAAGAAAAGAAGACATGGTGTGG - Intronic
1034987277 7:155524080-155524102 GCAGAAATGATTCCCTCGTGGGG - Intronic
1037103756 8:15079977-15079999 ACAGAAATGAAGGGTTGGAGAGG - Intronic
1037236694 8:16728606-16728628 GAAGAAATGAAGGCTGGGTTTGG - Intergenic
1037862089 8:22412528-22412550 GCAGCACTGAGTGCCTGGTGCGG + Intronic
1038011727 8:23481403-23481425 GCACAACAGAGGGCCTGGTGGGG + Intergenic
1038546247 8:28427702-28427724 GAAGAAATTAAGGCCAGGCGTGG + Intronic
1038712540 8:29961231-29961253 GAAGAAAGGAAGGCTTGGTAGGG - Intergenic
1039778692 8:40762362-40762384 ACAGAGAAGAAGGCCAGGTGTGG + Intronic
1040051483 8:43019197-43019219 GCAGAAGTGAATGTTTGGTGAGG + Exonic
1040430556 8:47337419-47337441 ACACAAATAAAGGCCAGGTGTGG - Intronic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1040863238 8:52022583-52022605 GCAGAAATGGAGGCCTTGAACGG - Intergenic
1041152297 8:54948015-54948037 GCAGAAATTAAGGCCAGGCGTGG + Intergenic
1041766263 8:61421298-61421320 GCAGCAAAGTGGGCCTGGTGAGG + Intronic
1041915671 8:63136541-63136563 CCAGAATCGAAGGCCTGGTTTGG + Intergenic
1042031629 8:64482529-64482551 GCAGAAATGGAGTCCAGGTCAGG - Intergenic
1043831307 8:84992341-84992363 GGAGAAAGGAAGACCTGGTTAGG - Intergenic
1044372897 8:91434519-91434541 GAAGAAATGAAAGCCTAGTATGG - Intergenic
1044923693 8:97191157-97191179 GCAAAAAGGAAGACCTGGAGAGG - Intergenic
1045534392 8:103013363-103013385 GCAAAAATTAAGACCGGGTGTGG + Intergenic
1046239263 8:111470453-111470475 GCAGCAAGGGAGGCGTGGTGGGG + Intergenic
1046669851 8:117045307-117045329 GATGAAATGGAAGCCTGGTGAGG - Intronic
1047144206 8:122178460-122178482 ATAGAAATTAAGGCCGGGTGTGG - Intergenic
1047435845 8:124834924-124834946 CCAGAAACCAAGGCCTGGAGGGG - Intergenic
1047769889 8:128022159-128022181 GCAGAGCTGCAGGCCTTGTGTGG + Intergenic
1049045012 8:140142788-140142810 GAAGAAATGAAGGTTTGGAGAGG - Intronic
1049666548 8:143846160-143846182 GCAGCCATGAAGGCCTGTGGCGG + Intergenic
1050077336 9:1878537-1878559 AAAAAAAAGAAGGCCTGGTGTGG - Intergenic
1050278684 9:4027743-4027765 GCAGAAATAATGGACTGGTTAGG - Intronic
1050471147 9:5991854-5991876 GCAGAAAATTAGGCCTGGAGAGG - Intronic
1050526575 9:6551756-6551778 GCAGAAATGAAGGCGTGGAAGGG + Intronic
1051191020 9:14513337-14513359 ACAGAAATGAAGGCCGGGTGTGG + Intergenic
1051432377 9:16992998-16993020 TCAAAAATAAAGGCCGGGTGCGG - Intergenic
1051465994 9:17378467-17378489 GAACAAAAGAAGGCCGGGTGCGG - Intronic
1052542761 9:29831730-29831752 GCAGAAATGACTGCCTGGAAAGG - Intergenic
1052707595 9:32011297-32011319 GCAGAGGTGAAGCCCTGGTGTGG - Intergenic
1053273981 9:36769786-36769808 GAAGAAATGAAAGCCTGAAGAGG - Intergenic
1055374558 9:75634839-75634861 GCAGAAATGATTGACTGCTGAGG + Intergenic
1055752037 9:79517396-79517418 GAAGAAATGGAGGCTGGGTGCGG + Intergenic
1056170134 9:83977622-83977644 GTAGAAATTAAGGTCTGGTTTGG - Intronic
1057035500 9:91809199-91809221 GCATAAAAGAACACCTGGTGGGG - Intronic
1057156718 9:92848595-92848617 ACAGAAAATAAGGCCAGGTGCGG + Intronic
1057617435 9:96604646-96604668 GCAAAAAAAAAGGCCAGGTGTGG - Intronic
1057754531 9:97821424-97821446 GCAGGTAAGAAGGCATGGTGGGG + Intergenic
1058493357 9:105526591-105526613 GCAGACATGAAGGCCTGAAAGGG - Intronic
1058577450 9:106419120-106419142 GCAGTGCTGAAAGCCTGGTGGGG + Intergenic
1059078482 9:111221078-111221100 GAAGAAATATAGGCCAGGTGCGG - Intergenic
1059355027 9:113692120-113692142 ACAGAAATGCAGGCCGGGCGTGG - Intergenic
1059438935 9:114291952-114291974 CAACAAATGGAGGCCTGGTGGGG - Intronic
1059942813 9:119374363-119374385 GCAGAAATGATGGGCTGCTAGGG - Intergenic
1060072507 9:120562637-120562659 GCAGTAATGAGGGCAAGGTGAGG - Intronic
1060301572 9:122377369-122377391 GCAGAAATGGAGGAATGGTGAGG + Intronic
1061301799 9:129709803-129709825 GGAGCCATGGAGGCCTGGTGAGG - Intronic
1062268267 9:135697275-135697297 GCAGAATTGAGGGCCTGGGCTGG - Intronic
1062486341 9:136778343-136778365 GCAGAGCTGGAGGCCTGGGGAGG - Intergenic
1203368009 Un_KI270442v1:275158-275180 TCAGAAGTAAAGGCCGGGTGTGG + Intergenic
1186115743 X:6303634-6303656 GCAGCATTGAAGGCCAGGCGTGG + Intergenic
1186577018 X:10777485-10777507 AAAGAAAAAAAGGCCTGGTGTGG - Intronic
1187003600 X:15208080-15208102 GCATAAATGAAGGACTGGAATGG - Intergenic
1187144959 X:16629037-16629059 GCAGAAACTGAGGCGTGGTGCGG + Intronic
1187496382 X:19799226-19799248 GCAGAAATGGATGCCTGCAGGGG + Intronic
1187683461 X:21792385-21792407 GCAGAAATAAAGTCCTCATGTGG - Intergenic
1187880935 X:23846712-23846734 TCAGAGATGAAGGCCAGTTGTGG - Intronic
1188380133 X:29481504-29481526 GCTGAAATGAGGTGCTGGTGTGG + Intronic
1189612480 X:42752172-42752194 ATAGAAATTAAGGCCGGGTGCGG + Intergenic
1190059312 X:47200828-47200850 GAAAAAATGGAGGGCTGGTGTGG - Intronic
1190284804 X:48955008-48955030 ACAGAAAGGATTGCCTGGTGTGG + Intronic
1190441963 X:50483655-50483677 GGAGAAATGGAGGCTTGGAGTGG + Intergenic
1190572716 X:51800540-51800562 GAAGGGATGAAGGCCAGGTGTGG - Intergenic
1190726934 X:53195875-53195897 GCTGGACTGAAGGCCTGGGGTGG + Intronic
1191214898 X:57923845-57923867 TCAAAACTGAAGCCCTGGTGGGG + Intergenic
1191881332 X:65846320-65846342 GAAGAAATGAAGGCTCAGTGAGG + Intergenic
1191995471 X:67090726-67090748 ACAGAAATGTAGGCCAGGTCTGG + Intergenic
1194284169 X:91989270-91989292 GAAGAAAAGAAGGCCGGGCGCGG + Intronic
1196304950 X:114090611-114090633 GTTGAAATGAAGTCCAGGTGTGG + Intergenic
1197198510 X:123727754-123727776 GAAAAAATGAATGCCTGGCGTGG - Intronic
1197731410 X:129813375-129813397 TCATAAATGAAGAACTGGTGGGG + Intronic
1197733606 X:129833179-129833201 GCAGAAATGAAGACTTAGTTGGG - Intronic
1198639181 X:138737462-138737484 GCAGAAATGAATGCAAGCTGTGG - Intronic
1199666821 X:150102799-150102821 GAGGAAATGGAGGCCTGGGGAGG - Intergenic
1199776986 X:151021037-151021059 GAAAAAAAGAAGGCCAGGTGAGG + Intergenic
1201368428 Y:13234682-13234704 GCAGAGATGAGGCCCTGGAGTGG + Intergenic
1201868120 Y:18676793-18676815 TAAGGAATCAAGGCCTGGTGTGG - Intergenic
1202186407 Y:22188989-22189011 GATGAAATGAAGGTCTGGTTTGG - Intergenic
1202204952 Y:22397407-22397429 GATGAAATGAAGGTCTGGTTTGG + Intronic