ID: 1069980260

View in Genome Browser
Species Human (GRCh38)
Location 10:72247591-72247613
Sequence CTCTGCAATGCCAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069980250_1069980260 24 Left 1069980250 10:72247544-72247566 CCTAGGACACATGAAAACCCTTT No data
Right 1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG No data
1069980257_1069980260 -5 Left 1069980257 10:72247573-72247595 CCAACATCTGGAAAGGGACTCTG No data
Right 1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG No data
1069980253_1069980260 6 Left 1069980253 10:72247562-72247584 CCTTTTACCAACCAACATCTGGA No data
Right 1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG No data
1069980251_1069980260 7 Left 1069980251 10:72247561-72247583 CCCTTTTACCAACCAACATCTGG No data
Right 1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG No data
1069980256_1069980260 -1 Left 1069980256 10:72247569-72247591 CCAACCAACATCTGGAAAGGGAC No data
Right 1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069980260 Original CRISPR CTCTGCAATGCCAGGGTAGA AGG Intergenic
No off target data available for this crispr